| Id Trinity | FTRINITY_DN34220_c0_g1_i1 |
|---|---|
| Name Transcript | Ll_transcript_61981 |
| Sequence | GAAAAACTCAGAATAAAACGATATAATATTATATATAATCATCTATTTTCTGACGAAATACTGCTAACTGGTCATCATATAAATGATCAATGTGAAACTT TCTTTTTATCTTTAAAAAGAGGAAGTGGTCCTACTGGTCTTTCCAGCATGTCTTTTGAGACTTTATTTGGGACTAAAAAAATAGTTCGTCCTTTTCTAAA AAAAACAAAAATAGAACTACAAACATGGGCTAAGAAAAAAAAATTACACTGGATTGAAGACTTCAGAAATTTAA BLAST |
| Tissue | flowers |
| Gene name | LI_gene_7182; |
| Additional information | - |
| FPAB | abscising flower pedicels |
| FPNAB | non-abscising flower pedicels |
| LF1 | lower flowers stage 1 |
| LF2 | lower flowers stage 2 |
| LF3 | lower flowers stage 3 |
| LF4 | lower flowers stage 4 |
| UF1 | upper flowers stage 1 |
| UF2 | upper flowers stage 2 |
| UF3 | upper flowers stage 3 |
| UF4 | upper flowers stage 4 |
Annotations of Ll_transcript_61981
| Blastp | - |
|---|---|
| Blastx | tRNA(Ile)-lysidine synthase from Buchnera with 98.9% of identity |
| Eggnog | Ligates lysine onto the cytidine present at position 34 of the AUA codon-specific tRNA(Ile) that contains the anticodon CAU, in an ATP-dependent manner. Cytidine is converted to lysidine, thus changing the amino acid specificity of the tRNA from methionine to isoleucine (By similarity)(COG0037) |
| Kegg | Link to kegg annotations (BU110) |
| CantataDB | - |
| Mirbase | - |
| Ncbi protein | Link to NCBI protein (XP_020209622.1) |
| Pfam | - |
| Rfam | - |
| GO | Links to GO: General; Genes and gene products; Annotations; Ontology; |