| Id Trinity | FTRINITY_DN3477_c0_g1_i1 |
|---|---|
| Name Transcript | Ll_transcript_134047 |
| Sequence | GGACTTCGGCGTCCAAAAACTATAACAAAATGGTCCGAATTAACGTTTTGGCCGACGCCCTCAAAACTATCAACAATGCTGAAAAGCGCGGTAAACGCCA GGTCCTTATCAGGCCTAACTCTAAGGTTATCGTCAAATTCTTGGGAGTTATGATGAAGAAAGGATATATCGGAGAATTTGAAATTGTTGATGACCACCGT GCTGGCAAGATTGTCGTCAACCTCACGGGCAGACTTAACAAATGTGGTGTGATCTCACCCAGGTTCGATGTGCCCATTAGGGATATTGAAAAGTGGACCA ACAACTTGTTGCCCTCACGTCAGTTCGGGTATGTGGTTCTTACCACTTCCGGTGGTATCATGGATCATG BLAST |
| Tissue | flowers |
| Gene name | LI_gene_7370; |
| Additional information | details; |
| FPAB | abscising flower pedicels |
| FPNAB | non-abscising flower pedicels |
| LF1 | lower flowers stage 1 |
| LF2 | lower flowers stage 2 |
| LF3 | lower flowers stage 3 |
| LF4 | lower flowers stage 4 |
| UF1 | upper flowers stage 1 |
| UF2 | upper flowers stage 2 |
| UF3 | upper flowers stage 3 |
| UF4 | upper flowers stage 4 |
Annotations of Ll_transcript_134047
| Blastp | 40S ribosomal protein S15a from Sophophora with 92.04% of identity |
|---|---|
| Blastx | 40S ribosomal protein S15a from Sophophora with 92.04% of identity |
| Eggnog | One of the primary rRNA binding proteins, it binds directly to 16S rRNA central domain where it helps coordinate assembly of the platform of the 30S subunit (By similarity)(COG0096) |
| Kegg | Link to kegg annotations (Dyak_GE16163) |
| CantataDB | - |
| Mirbase | - |
| Ncbi protein | Link to NCBI protein (XP_014505890.1) |
| Pfam | Ribosomal protein S8 (PF00410.18) |
| Rfam | - |
| GO | Links to GO: General; Genes and gene products; Annotations; Ontology; Links to GO: General; Genes and gene products; Annotations; Ontology; |