| Id Trinity | FTRINITY_DN34814_c0_g1_i1 |
|---|---|
| Name Transcript | Ll_transcript_104027 |
| Sequence | AATTAATCATGAATTCGTACCAATTCATAAATCCAGTCAAAGATAGAGAATTGGATTTGAGAGGTTATAAAATACCACTGATTGAAAACATGGGTGCAAC ACTTGATCAGTTTGATACAATTGACTTTTCAGACAATGATATCAGGAAAATTGATGGTTTTGCATACCTTAAAAGATTGAAAAACCTCATATTTAATAAC AATGCTATTGTACGTATATCAGATAACTTAGAACAATGTCTACCAAATCTTGAATCTTTAATACTAACAGGTAATCAGATTCAAGAGCTTGGAGATTTAG ATCCTCTTGCTTCACTTCCGAAGTTGAAAATGTTGAGTCTTTTACATAACCCAGTTGCATCAAAAGAGCATTATCGACTTTATGTAGCACATAAAATTCC GCAAGTTCGAATTTTGGACTTCAGA BLAST |
| Tissue | flowers |
| Gene name | LI_gene_7385; |
| Additional information | details; |
| FPAB | abscising flower pedicels |
| FPNAB | non-abscising flower pedicels |
| LF1 | lower flowers stage 1 |
| LF2 | lower flowers stage 2 |
| LF3 | lower flowers stage 3 |
| LF4 | lower flowers stage 4 |
| UF1 | upper flowers stage 1 |
| UF2 | upper flowers stage 2 |
| UF3 | upper flowers stage 3 |
| UF4 | upper flowers stage 4 |
Annotations of Ll_transcript_104027
| Blastp | U2 small nuclear ribonucleoprotein A' from Mus with 66.67% of identity |
|---|---|
| Blastx | U2 small nuclear ribonucleoprotein A' from Mus with 66.67% of identity |
| Eggnog | leucine Rich Repeat(COG4886) |
| Kegg | Link to kegg annotations (68981) |
| CantataDB | - |
| Mirbase | - |
| Ncbi protein | Link to NCBI protein (XP_016198385.1) |
| Pfam | Leucine-rich repeat (PF14580.5) |
| Rfam | - |
| GO | Links to GO: General; Genes and gene products; Annotations; Ontology; Links to GO: General; Genes and gene products; Annotations; Ontology; |