| Id Trinity | FTRINITY_DN35280_c0_g1_i1 |
|---|---|
| Name Transcript | Ll_transcript_46474 |
| Sequence | GTCAGTTGACTCATAAATTGTTCGCTGTGCAGTGTGCATACTACAACGTTACAGTTTGCGTCACATTACGCAATATTTTATTAAATTTTGAATCCGTCCC AGTATTTTTAGCCAGTAAAAAAATGATGCCCTTAGTCAGCGATAAATCCATTGCACCCGCGTTGGAGAATAAGCCCGCCGAAGAACCAAAAAAATTGAAA GCTTGTTGTGCTTGTCCGGACACAAAAAGAGTCAGAGATGCTTGTATTATGGAAAATGGAGAAGAAAAATGTGGACATCTAATTGAAGCACATAAGGAAT GCATGAGAAAAATG BLAST |
| Tissue | flowers |
| Gene name | LI_gene_7534; |
| Additional information | details; |
| FPAB | abscising flower pedicels |
| FPNAB | non-abscising flower pedicels |
| LF1 | lower flowers stage 1 |
| LF2 | lower flowers stage 2 |
| LF3 | lower flowers stage 3 |
| LF4 | lower flowers stage 4 |
| UF1 | upper flowers stage 1 |
| UF2 | upper flowers stage 2 |
| UF3 | upper flowers stage 3 |
| UF4 | upper flowers stage 4 |
Annotations of Ll_transcript_46474
| Blastp | Cytochrome c oxidase copper chaperone from Canis with 60.32% of identity |
|---|---|
| Blastx | Cytochrome c oxidase copper chaperone from Canis with 60.32% of identity |
| Eggnog | cytochrome C oxidase(ENOG410XVYQ) |
| Kegg | Link to kegg annotations (503668) |
| CantataDB | - |
| Mirbase | - |
| Ncbi protein | Link to NCBI protein (XP_015954078.1) |
| Pfam | Cytochrome C oxidase copper chaperone (COX17) (PF05051.12) |
| Rfam | - |
| GO | Links to GO: General; Genes and gene products; Annotations; Ontology; Links to GO: General; Genes and gene products; Annotations; Ontology; |