| Id Trinity | FTRINITY_DN35559_c0_g1_i1 |
|---|---|
| Name Transcript | Ll_transcript_227786 |
| Sequence | ATATTATACTAGAGCTAATAAGTCATAGTGTCTTTGAGACATAGAGAAATTAAGTTGGAAAAGAATGAAGGGAGGTTCAATTGAAGGTGGTGAAATCTCT AAGGGTGTATCCATAAGAAAAGGGATGACAAAAGGGTTGTCTATAATGGATTTTATTTTGAGAATTGTTGCAGCTATTGCAACACTAGCTAGTGCAGTGT CTATGGCAACAACTAATGAGACTCTTCCATTTGTGACACAGTTTGTAAGGTTCAGGGCTGAATTTGATGACCTTCCAACATTTATGTTTTTTGTGACTGC CAATTCTGTTGTTAGTGGCTATCTGGTGCTTTCACTTGTACTGTCTATCTTCCACATAGTGAGGAGCTCTGCAGTAAAAACTAGAATTCTACTGGTTGCT CTTGACACGGTAATGTTGGGTCTACTAACAGCTGCAGCCTCTGCAGCAGCAGCAATTGTATATATAGCAC BLAST |
| Tissue | flowers |
| Gene name | LI_gene_7633; |
| Additional information | details; |
| FPAB | abscising flower pedicels |
| FPNAB | non-abscising flower pedicels |
| LF1 | lower flowers stage 1 |
| LF2 | lower flowers stage 2 |
| LF3 | lower flowers stage 3 |
| LF4 | lower flowers stage 4 |
| UF1 | upper flowers stage 1 |
| UF2 | upper flowers stage 2 |
| UF3 | upper flowers stage 3 |
| UF4 | upper flowers stage 4 |
Annotations of Ll_transcript_227786
| Blastp | CASP-like protein 7 from Soja with 74.07% of identity |
|---|---|
| Blastx | CASP-like protein 7 from Soja with 74.17% of identity |
| Eggnog | cell wall deposition. Required for establishment of the Casparian strip membrane domain (CSD) and the subsequent formation of Casparian strips, a cell wall modification of the root endodermis that determines an apoplastic barrier between the intraorganismal apoplasm and the extraorganismal apoplasm and prevents lateral diffusion(ENOG410YGEC) |
| Kegg | Link to kegg annotations (100500346) |
| CantataDB | - |
| Mirbase | - |
| Ncbi protein | Link to NCBI protein (XP_019456216.1) |
| Pfam | Domain of unknown function (DUF588) (PF04535.11) |
| Rfam | - |
| GO | Links to GO: General; Genes and gene products; Annotations; Ontology; |