| Id Trinity | FTRINITY_DN35634_c0_g1_i1 |
|---|---|
| Name Transcript | Ll_transcript_96951 |
| Sequence | GGAAAGGTGGAATTGGACATTATATTGGTTTATGTGTGCTAGCTGCTTGTTTTGGATTAGCTGATGGTCTTGTCCAAGGTGGCATGGTAGGAGATCTAAG TTTTATGTGCCCTGAGTTTATCCAGTCCTACCTAGCTGGATTAGCAGCATCAGGGGCTCTAATTTCAATTCTGAGAGTGCTGACTAAACTCACTTTTGAG AAATCTCATAATGGACTTCâBLAST |
| Tissue | flowers |
| Gene name | LI_gene_7660; |
| Additional information | - |
| FPAB | abscising flower pedicels |
| FPNAB | non-abscising flower pedicels |
| LF1 | lower flowers stage 1 |
| LF2 | lower flowers stage 2 |
| LF3 | lower flowers stage 3 |
| LF4 | lower flowers stage 4 |
| UF1 | upper flowers stage 1 |
| UF2 | upper flowers stage 2 |
| UF3 | upper flowers stage 3 |
| UF4 | upper flowers stage 4 |
Annotations of Ll_transcript_96951
| Blastp | - |
|---|---|
| Blastx | Equilibrative nucleotide transporter 4 from Arabidopsis with 66.2% of identity |
| Eggnog | solute carrier family 29 (nucleoside transporters), member(ENOG410Y3MT) |
| Kegg | Link to kegg annotations (AT4G05130) |
| CantataDB | - |
| Mirbase | - |
| Ncbi protein | Link to NCBI protein (XP_019440311.1) |
| Pfam | - |
| Rfam | - |
| GO | Links to GO: General; Genes and gene products; Annotations; Ontology; |