Id Trinity | FTRINITY_DN35744_c0_g1_i1 |
---|---|
Name Transcript | Ll_transcript_183058 |
Sequence | GAAAGGTCCTGAATTACTTACCATGTGGTTTGGTGAAAGTGAAGCCAATGTTCGAGAAATATTTGACAAGGCTAGACAATCGGCTCCATGTGTCCTCTTC TTTGATGAGCTTGACTCCATTGCCACTCAGAGAGGAAGCAGTGGTGGGGATGCTGGTGGTGCTGCTGATAGAGTTCTGAACCAGCTTCTGACTGAAATGG ACGGCATGAATGCGAAAAAGACCGTGTTCATAATTGGGGCAACCAATAGACCTGACATCATTGATTCGGCACTTCTTCGGCCAGGCCGTCTGGACCAATT GATCTATATTCCTCTTCCTGATGAGGAGTCACGTTATCAAATCTTCAAGGCCTGCACGAGGAAGTCCCCTGTCTCGAAAGATGTTGATTTGAGCGCGCTA GCTAAGTATACTCAAGGCTTCAGTGGTGCTGATATAA BLAST |
Tissue | flowers |
Gene name | LI_gene_7697; |
Additional information | details; |
FPAB | abscising flower pedicels |
FPNAB | non-abscising flower pedicels |
LF1 | lower flowers stage 1 |
LF2 | lower flowers stage 2 |
LF3 | lower flowers stage 3 |
LF4 | lower flowers stage 4 |
UF1 | upper flowers stage 1 |
UF2 | upper flowers stage 2 |
UF3 | upper flowers stage 3 |
UF4 | upper flowers stage 4 |
Annotations of Ll_transcript_183058
Blastp | Cell division control protein 48 homolog D from Arabidopsis with 95.17% of identity |
---|---|
Blastx | Cell division control protein 48 homolog D from Arabidopsis with 95.17% of identity |
Eggnog | Aaa atpase(COG0464) |
Kegg | Link to kegg annotations (AT3G53230) |
CantataDB | - |
Mirbase | - |
Ncbi protein | Link to NCBI protein (XP_019451653.1) |
Pfam | ATPase family associated with various cellular activities (AAA) (PF00004.28) |
Rfam | - |
GO | Links to GO: General; Genes and gene products; Annotations; Ontology; Links to GO: General; Genes and gene products; Annotations; Ontology; |