| Id Trinity | FTRINITY_DN35905_c0_g1_i1 |
|---|---|
| Name Transcript | Ll_transcript_48690 |
| Sequence | GTAAAGTGGTTTCTTAAGATGGAATCTACTCCTGGTAAATATGCTATGAACATTATTGAAATGACAGCAAAGCATTTAAAATATTACATAAGCTTGGTTG ATAAACCAGCAGTAGGGTTTGAAGGGATTGACTCCAATTTTAAAGAAGTTCTGCTGTGGGTAAAATGCTACCAAATAGGACTGCATGCTACAGAAAAATT TTTTGTGAAAGGGAGAATCAGTCGATGCAGCAAACTTCATTG BLAST |
| Tissue | flowers |
| Gene name | LI_gene_7752; |
| Additional information | - |
| FPAB | abscising flower pedicels |
| FPNAB | non-abscising flower pedicels |
| LF1 | lower flowers stage 1 |
| LF2 | lower flowers stage 2 |
| LF3 | lower flowers stage 3 |
| LF4 | lower flowers stage 4 |
| UF1 | upper flowers stage 1 |
| UF2 | upper flowers stage 2 |
| UF3 | upper flowers stage 3 |
| UF4 | upper flowers stage 4 |
Annotations of Ll_transcript_48690
| Blastp | - |
|---|---|
| Blastx | Tigger transposable element-derived protein 1 from Homo with 72.34% of identity |
| Eggnog | tigger transposable element derived(ENOG4110CDI) |
| Kegg | Link to kegg annotations (200765) |
| CantataDB | - |
| Mirbase | hsa-mir-1255b-1 (MI0006435) |
| Ncbi protein | Link to NCBI protein (XP_020230297.1) |
| Pfam | - |
| Rfam | - |
| GO | Links to GO: General; Genes and gene products; Annotations; Ontology; |