Id Trinity | FTRINITY_DN36062_c0_g1_i1 |
---|---|
Name Transcript | Ll_transcript_247219 |
Sequence | TAAAAATGGGTTTAATAGTAATTCGAGGTCTATGTCTAACTACAGCAAATTTTCCGAACACAAAAAGCTAAATCTCATAAGAAACATCGGAATTTCCGCC CATATTGACTCAGGGAAAACCACATTAACAGAAAGAATCCTTTTTTACACAGGTCGTATCGAGTCTATGCACGAAGTTAAAGGTAAAGACAATGTAGGCG CTACAATGGACTCCATGGAACTGGAACGTCAAAGAGGCATCACCATACAATCCGCGGCCACGTACACAA BLAST |
Tissue | flowers |
Gene name | LI_gene_7805; |
Additional information | - |
FPAB | abscising flower pedicels |
FPNAB | non-abscising flower pedicels |
LF1 | lower flowers stage 1 |
LF2 | lower flowers stage 2 |
LF3 | lower flowers stage 3 |
LF4 | lower flowers stage 4 |
UF1 | upper flowers stage 1 |
UF2 | upper flowers stage 2 |
UF3 | upper flowers stage 3 |
UF4 | upper flowers stage 4 |
Annotations of Ll_transcript_247219
Blastp | - |
---|---|
Blastx | Elongation factor G, mitochondrial from Culex with 78.65% of identity |
Eggnog | Catalyzes the GTP-dependent ribosomal translocation step during translation elongation. During this step, the ribosome changes from the pre-translocational (PRE) to the post- translocational (POST) state as the newly formed A-site-bound peptidyl-tRNA and P-site-bound deacylated tRNA move to the P and E sites, respectively. Catalyzes the coordinated movement of the two tRNA molecules, the mRNA and conformational changes in the ribosome (By similarity)(COG0480) |
Kegg | Link to kegg annotations (CpipJ_CPIJ005834) |
CantataDB | - |
Mirbase | - |
Ncbi protein | Link to NCBI protein (XP_020970089.1) |
Pfam | - |
Rfam | - |
GO | Links to GO: General; Genes and gene products; Annotations; Ontology; |