Id Trinity | FTRINITY_DN36134_c0_g1_i1 |
---|---|
Name Transcript | Ll_transcript_205910 |
Sequence | CTTCATAGAAATGCCCAGCTGGCCATGCGACCCGGAACGTACCATTATTTTGCACAAGCCTAAGACCAACGAAATCGTTTCGTATGGCAGCGGTTACGGC GGTAACTCTCTGTTGGGAAAGAAATGTTTTGCTTTGAGGATTGGTTCCACTATTGCTAAAAGGGAAGGTTGGCTGGCAGAACATATGCTGATTCTTGGCA TTACAAATCCTAAAGGCAAAAAACGTTACATAGCCGCCGCTTTTCCATCTGCTTGCGGAAAAACTAATTTGGCCATGATGACGCCTACTTTGCCTGGCTA CAAAATCGAATGTGTTGGTGATGATATTGCGTGGATGAGGTTCGATAAAGATGGAAAACTAAGAGCCATTAATCTAGAAAAT BLAST |
Tissue | flowers |
Gene name | LI_gene_7826; |
Additional information | details; |
FPAB | abscising flower pedicels |
FPNAB | non-abscising flower pedicels |
LF1 | lower flowers stage 1 |
LF2 | lower flowers stage 2 |
LF3 | lower flowers stage 3 |
LF4 | lower flowers stage 4 |
UF1 | upper flowers stage 1 |
UF2 | upper flowers stage 2 |
UF3 | upper flowers stage 3 |
UF4 | upper flowers stage 4 |
Annotations of Ll_transcript_205910
Blastp | Phosphoenolpyruvate carboxykinase [GTP] from Sophophora with 83.33% of identity |
---|---|
Blastx | Phosphoenolpyruvate carboxykinase [GTP] from Sophophora with 83.33% of identity |
Eggnog | Catalyzes the conversion of oxaloacetate (OAA) to phosphoenolpyruvate (PEP), the rate-limiting step in the metabolic pathway that produces glucose from lactate and other precursors derived from the citric acid cycle (By similarity)(COG1274) |
Kegg | Link to kegg annotations (Dmel_CG17725) |
CantataDB | - |
Mirbase | - |
Ncbi protein | Link to NCBI protein (XP_020230452.1) |
Pfam | Phosphoenolpyruvate carboxykinase N-terminal domain (PF17297.1) |
Rfam | - |
GO | Links to GO: General; Genes and gene products; Annotations; Ontology; Links to GO: General; Genes and gene products; Annotations; Ontology; |