| Id Trinity | FTRINITY_DN37045_c0_g1_i1 |
|---|---|
| Name Transcript | Ll_transcript_26535 |
| Sequence | GTTCGTAAGACATCAGAGTGACCGCTATGGAAAGCTCAAGCGCAACTGGAGGAAGCCTAAGGGTATTGACAACAGGGTTCGTAGGCGCTTCAAGGGACAG TACCTGATGCCCAACATTGGTTATGGTAGCAGTGTGAAGACAAAGCACATGCTGCCAACTGGCTTCCGCAAGGTTCTTGTTCACAATGTCAAGGAGTTGG AGGTCCTCATGATGCAGAACAGGAAATTCTGCGGAGAAATCGCCCATGGTGTTTCTGCCAAGAAGCGGAAGGCAATTGTCGAACGTGCCCAACAGCTTTC AGTCAGGTTGACCAATGGCAACGCACGTATGCGTAGTGAGGAG BLAST |
| Tissue | flowers |
| Gene name | LI_gene_8116; |
| Additional information | details; |
| FPAB | abscising flower pedicels |
| FPNAB | non-abscising flower pedicels |
| LF1 | lower flowers stage 1 |
| LF2 | lower flowers stage 2 |
| LF3 | lower flowers stage 3 |
| LF4 | lower flowers stage 4 |
| UF1 | upper flowers stage 1 |
| UF2 | upper flowers stage 2 |
| UF3 | upper flowers stage 3 |
| UF4 | upper flowers stage 4 |
Annotations of Ll_transcript_26535
| Blastp | 60S ribosomal protein L32 from Apis with 85.96% of identity |
|---|---|
| Blastx | 60S ribosomal protein L32 from Apis with 85.96% of identity |
| Eggnog | (ribosomal) protein(COG1717) |
| Kegg | Link to kegg annotations (406099) |
| CantataDB | - |
| Mirbase | - |
| Ncbi protein | Link to NCBI protein (NP_001238278.1) |
| Pfam | Ribosomal protein L32 (PF01655.17) |
| Rfam | - |
| GO | Links to GO: General; Genes and gene products; Annotations; Ontology; Links to GO: General; Genes and gene products; Annotations; Ontology; |