| Id Trinity | FTRINITY_DN37360_c0_g1_i1 |
|---|---|
| Name Transcript | Ll_transcript_117494 |
| Sequence | CTATGATCCTGAAGCCAAGGTAATGATCCCGGCACACAAACTAGAGCTCTGGCCTGGGTACAAGACTAGCATCAGGCAACACGAGAAGGATATTCTGATG TGTGTTGAGGTCACTCACAAAGTGTTGAGAGATAAGACAGCTTCAGATGTGCTGGCTGATTGTTACCGGAACAACTCTCAGTACTACAAGGAGGATTTCT TGAAAGAAATGATTGGTTGCATAGTCATCACGAAATACAACAACAAAACCTATAGAATTGACGATATTGATTGGGATAGAAATCCTGGGTATAAATTTAA ATTCAGGGACCAAGAAATAAGCTATGCTGAGTATATGTTCAAC BLAST |
| Tissue | flowers |
| Gene name | LI_gene_8229; |
| Additional information | details; |
| FPAB | abscising flower pedicels |
| FPNAB | non-abscising flower pedicels |
| LF1 | lower flowers stage 1 |
| LF2 | lower flowers stage 2 |
| LF3 | lower flowers stage 3 |
| LF4 | lower flowers stage 4 |
| UF1 | upper flowers stage 1 |
| UF2 | upper flowers stage 2 |
| UF3 | upper flowers stage 3 |
| UF4 | upper flowers stage 4 |
Annotations of Ll_transcript_117494
| Blastp | Piwi-like protein 1 from Mus with 49.56% of identity |
|---|---|
| Blastx | Piwi-like protein 1 from Mus with 49.56% of identity |
| Eggnog | piwi-like(ENOG410XNRH) |
| Kegg | Link to kegg annotations (57749) |
| CantataDB | - |
| Mirbase | - |
| Ncbi protein | Link to NCBI protein (XP_006582596.1) |
| Pfam | PAZ domain (PF02170.21) |
| Rfam | - |
| GO | Links to GO: General; Genes and gene products; Annotations; Ontology; Links to GO: General; Genes and gene products; Annotations; Ontology; |