Ll_transcript_275832

• Id Trinity: FTRINITY_DN37643_c0_g1_i1
• Name Transcript: Ll_transcript_275832
• Sequence: CCGGACTTCGACATAATCACCAACCACAGGATTTCGCTTTGTATTAACATCTTCCCTGTCTGGGATTGGCTGGTTTACAAATAAAACTCGGTGGCCCTTG TCACTCTTGCCCATAAGCTCGGTATCTGGAGCTCTTCTGTTGGGTCCTTCAACTAATACTAGCTGTATAGTTCCGATCTGAGAGTCGTAACACTTGCCTG TGCTGTCGCGGAAAGTCTCAATAAGTTCA
• Tissue: flowers
• Gene name: LI_gene_8301;
• Additional information: -

Expression of Ll_transcript_275832

FPKM

• FPAB: 0
• FPNAB: 0
• LF1: 0.5
• LF2: 0
• LF3: 0
• LF4: 0
• UF1: 3.4
• UF2: 0.6
• UF3: 0
• UF4: 0.5

Labels

• FPAB: abscising flower pedicels
• FPNAB   : non-abscising flower pedicels
• LF1: lower flowers stage 1
• LF2: lower flowers stage 2
• LF3: lower flowers stage 3
• LF4: lower flowers stage 4
• UF1: upper flowers stage 1
• UF2: upper flowers stage 2
• UF3: upper flowers stage 3
• UF4: upper flowers stage 4

Annotations of Ll_transcript_275832

• Blastp: -
• Blastx: CDK5RAP1-like protein from Arabidopsis with 61.25% of identity
• Eggnog: Catalyzes the methylthiolation of N6- (dimethylallyl)adenosine (i(6)A), leading to the formation of 2- methylthio-N6-(dimethylallyl)adenosine (ms(2)i(6)A) at position 37 in tRNAs that read codons beginning with uridine (By similarity)(COG0621)
• Kegg: Link to kegg annotations (AT4G36390)
• CantataDB: -
• Mirbase: -
• Ncbi protein: Link to NCBI protein (XP_019421840.1)
• Pfam: -
• Rfam: -
• GO: Links to GO: General; Genes and gene products; Annotations; Ontology;