| Id Trinity | FTRINITY_DN38217_c0_g1_i1 |
|---|---|
| Name Transcript | Ll_transcript_49131 |
| Sequence | CAGACATCGGGGAAGCTGTCAAAGTCTTACTTGCTTTGAAAGCAGAGTATAAAAGTATTGCTGGAGTTGATTTTCCTGCGGGTGGTATTCCCACACCACA GCTAGTCAGTAATGCCAATTCTGATCAAAGTAAACCTTCAGTAGATTCTATAGTTGTGAAAATTAATGAACAAGGAGATAAAGTGCGATCAATGAAAAAC AGTAAAGCTTCTAAAGCAGACATCGGGAAAGCGGAAGAACGCCTAGTTGGTATAGAGGC BLAST |
| Tissue | flowers |
| Gene name | LI_gene_8477; |
| Additional information | - |
| FPAB | abscising flower pedicels |
| FPNAB | non-abscising flower pedicels |
| LF1 | lower flowers stage 1 |
| LF2 | lower flowers stage 2 |
| LF3 | lower flowers stage 3 |
| LF4 | lower flowers stage 4 |
| UF1 | upper flowers stage 1 |
| UF2 | upper flowers stage 2 |
| UF3 | upper flowers stage 3 |
| UF4 | upper flowers stage 4 |
Annotations of Ll_transcript_49131
| Blastp | - |
|---|---|
| Blastx | Bifunctional glutamate/proline--tRNA ligase from Sophophora with 42.03% of identity |
| Eggnog | Catalyzes the attachment of glutamate to tRNA(Glu) in a two-step reaction glutamate is first activated by ATP to form Glu-AMP and then transferred to the acceptor end of tRNA(Glu) (By similarity)(COG0008) |
| Kegg | Link to kegg annotations (Dmel_CG5394) |
| CantataDB | - |
| Mirbase | - |
| Ncbi protein | Link to NCBI protein (XP_014627057.1) |
| Pfam | - |
| Rfam | - |
| GO | Links to GO: General; Genes and gene products; Annotations; Ontology; |