Id Trinity | FTRINITY_DN38294_c0_g1_i1 |
---|---|
Name Transcript | Ll_transcript_49115 |
Sequence | GAAGACTCTGTCATGTTGTTCTCAACATCAACCTTAAACGGGCTTAAAGATGGACAAGTAATCAGATCACTTTTCTGGAGCTTTTGACGACAGATTGGAC ATTTACCACCCGCTGAGGTCCCCCAGAAATTGAATAGGCATTCTTTACACAAGCTATATGCACATGGTGTAAACACAGGATCATCTGGTGACTCAAAACA TATAGGGCATTCTATGTTTTCACCATTTTGAATATTATCCATAACCCCATCAATGTATGCACGAGATTGGACTGCATTTGGAGCAGAATCAGTCTTCAGG AGGAACTTGGTTGCCAG BLAST |
Tissue | flowers |
Gene name | LI_gene_8503; |
Additional information | details; |
FPAB | abscising flower pedicels |
FPNAB | non-abscising flower pedicels |
LF1 | lower flowers stage 1 |
LF2 | lower flowers stage 2 |
LF3 | lower flowers stage 3 |
LF4 | lower flowers stage 4 |
UF1 | upper flowers stage 1 |
UF2 | upper flowers stage 2 |
UF3 | upper flowers stage 3 |
UF4 | upper flowers stage 4 |
Annotations of Ll_transcript_49115
Blastp | DNA repair protein RAD5B from Arabidopsis with 48.62% of identity |
---|---|
Blastx | DNA repair protein RAD5B from Arabidopsis with 48.62% of identity |
Eggnog | Transcription termination factor, RNA polymerase II(ENOG410XPDU) |
Kegg | Link to kegg annotations (AT5G43530) |
CantataDB | - |
Mirbase | - |
Ncbi protein | Link to NCBI protein (XP_019449940.1) |
Pfam | Zinc finger, C3HC4 type (RING finger) (PF13920.5) |
Rfam | - |
GO | Links to GO: General; Genes and gene products; Annotations; Ontology; Links to GO: General; Genes and gene products; Annotations; Ontology; |