Id Trinity | FTRINITY_DN38594_c0_g1_i1 |
---|---|
Name Transcript | Ll_transcript_199898 |
Sequence | AACCAGGATTTGCAAACACTTTGAGAGAAGCAATACCGAAAATTCACCAATCTGAAGGATTGAATGGATTTTACAAAAGCTTAGTGCCACTATGGATGAG ACAAATCCCTTACACAATGATGAAATTTGCATGTTTTGAAAAGACTATTGAATTGCTGTACAAATATGTAGTGCCTAAGCCTAGGGCAGAATGCACCAAG GGCGAACAATTGATTGTGACATTTGGAGCCGGTTACATTGCTGGTGTATTCTGTGCTATTGTTTCCCATCCAGCTGACACGTTAGTGTCTAAATTGAACC AAGCTAAAGGTGCCTCA BLAST |
Tissue | flowers |
Gene name | LI_gene_8590; |
Additional information | details; |
FPAB | abscising flower pedicels |
FPNAB | non-abscising flower pedicels |
LF1 | lower flowers stage 1 |
LF2 | lower flowers stage 2 |
LF3 | lower flowers stage 3 |
LF4 | lower flowers stage 4 |
UF1 | upper flowers stage 1 |
UF2 | upper flowers stage 2 |
UF3 | upper flowers stage 3 |
UF4 | upper flowers stage 4 |
Annotations of Ll_transcript_199898
Blastp | Phosphate carrier protein, mitochondrial from Mus with 76.19% of identity |
---|---|
Blastx | Phosphate carrier protein, mitochondrial from Mus with 76.19% of identity |
Eggnog | Phosphate carrier protein(ENOG410XPST) |
Kegg | Link to kegg annotations (18674) |
CantataDB | - |
Mirbase | - |
Ncbi protein | Link to NCBI protein (XP_019429663.1) |
Pfam | Mitochondrial carrier protein (PF00153.26) |
Rfam | - |
GO | Links to GO: General; Genes and gene products; Annotations; Ontology; |