Ll_transcript_12738

• Id Trinity: FTRINITY_DN39334_c0_g1_i1
• Name Transcript: Ll_transcript_12738
• Sequence: AAATACTTGACATATGAAACTAGGAATAATGTGCAGTTATTGATAAACAAATTATTTGAATTGCCTATGAAAAATGAAGATGGTTACATGTATGTAGATT TACCAGAACCTAGATATAATTTACCCCGTGAGAAACCATTACCAACACCTAAACCACTTACCAAATGGCAGAAATTTGCCATTGAAAAGGGAATCAAGAA AACACCTAAACCAAAAGCAACTTGGGATGACATTTTACAGAAATGGATACCAACTTATGGTTACAAAAAAGCTGCTGCAGACAAAGAAAAAGATTGGATA TTGGAAGTGCCTGGTAATGCTGCTGATCCAAATATTGATTTATTTGCTCAAAAACGAG
• Tissue: flowers
• Gene name: LI_gene_8829;
• Additional information: details;

Expression of Ll_transcript_12738

FPKM

• FPAB: 0.6
• FPNAB: 0
• LF1: 0
• LF2: 0
• LF3: 0
• LF4: 0.5
• UF1: 0
• UF2: 0
• UF3: 0
• UF4: 0

Labels

• FPAB: abscising flower pedicels
• FPNAB   : non-abscising flower pedicels
• LF1: lower flowers stage 1
• LF2: lower flowers stage 2
• LF3: lower flowers stage 3
• LF4: lower flowers stage 4
• UF1: upper flowers stage 1
• UF2: upper flowers stage 2
• UF3: upper flowers stage 3
• UF4: upper flowers stage 4

Annotations of Ll_transcript_12738

• Blastp: Ribosome biogenesis regulatory protein homolog from Caenorhabditis with 47.01% of identity
• Blastx: Ribosome biogenesis regulatory protein homolog from Caenorhabditis with 47.01% of identity
• Eggnog: ribosome biogenesis regulatory protein(COG5225)
• Kegg: Link to kegg annotations (CBG04617)
• CantataDB: -
• Mirbase: -
• Ncbi protein: Link to NCBI protein (XP_004485584.1)
• Pfam: Ribosome biogenesis regulatory protein (RRS1) (PF04939.11)
• Rfam: -
• GO: Links to GO: General; Genes and gene products; Annotations; Ontology;
  Links to GO: General; Genes and gene products; Annotations; Ontology;