| Id Trinity | FTRINITY_DN39599_c0_g1_i1 |
|---|---|
| Name Transcript | Ll_transcript_59181 |
| Sequence | AGGCCTGCTGGACGTTGACTGCTCAGAAGACATCATCAAAAATCTGATTCTTGTTGTCAGAGGACAGTTCTCCACTGATGAGTTGGTGGAAGAAGTGGAG AAGAGGAATCGCCTGAAGCTGCTTCTGCCATGGCTGGAGTCACGTGTCCATGAAGGTTGTGTTGAGCCTGCTACTCACAATGCTTTGGCCAAAATCTACA TCGATAGCAATAATAATCCTGAGAGATTCCTCAAAGAGAACCAGTATTATGACAGCCGAGTTGTTGGCAAGTATTGTGAGAAACGCGATCCTCACCTTGC ATGTGTGGCATATGAACGGG BLAST |
| Tissue | flowers |
| Gene name | LI_gene_8925; |
| Additional information | details; |
| FPAB | abscising flower pedicels |
| FPNAB | non-abscising flower pedicels |
| LF1 | lower flowers stage 1 |
| LF2 | lower flowers stage 2 |
| LF3 | lower flowers stage 3 |
| LF4 | lower flowers stage 4 |
| UF1 | upper flowers stage 1 |
| UF2 | upper flowers stage 2 |
| UF3 | upper flowers stage 3 |
| UF4 | upper flowers stage 4 |
Annotations of Ll_transcript_59181
| Blastp | Clathrin heavy chain from Sophophora with 97.17% of identity |
|---|---|
| Blastx | Clathrin heavy chain from Sophophora with 97.17% of identity |
| Eggnog | clathrin heavy chain(ENOG410XPH1) |
| Kegg | Link to kegg annotations (Dmel_CG9012) |
| CantataDB | - |
| Mirbase | - |
| Ncbi protein | Link to NCBI protein (XP_017436114.1) |
| Pfam | Region in Clathrin and VPS (PF00637.19) |
| Rfam | - |
| GO | Links to GO: General; Genes and gene products; Annotations; Ontology; Links to GO: General; Genes and gene products; Annotations; Ontology; |