Id Trinity | FTRINITY_DN39830_c0_g2_i1 |
---|---|
Name Transcript | Ll_transcript_270920 |
Sequence | CCTGCAAGGTTATTATTAGACACATCAAGTGCACTGAGAAAAGACAATCTTCCTAAGGAACCAGGGATAGGTCCTTGAAGATTATTATGAGATAGATATA GCAGTCCTATCATTTTTAGATCACCAAAGCTATCAGGAATGTTTCCAGTTAGTTCATTGTGTCCTAGATTTAAGACTTGCAAATAGGTCAGGGAACCGAT GTTTTGAGAGATACTTCCTGTTAAAAAATTGTTCGAAAGATCAAGGTAGATCATGCTGCCGTTCTTTGAGAATGTGTAAAGTGTAAGACCGGTGTATATC CGGCTTGACGGâBLAST |
Tissue | flowers |
Gene name | LI_gene_8999; |
Additional information | details; |
FPAB | abscising flower pedicels |
FPNAB | non-abscising flower pedicels |
LF1 | lower flowers stage 1 |
LF2 | lower flowers stage 2 |
LF3 | lower flowers stage 3 |
LF4 | lower flowers stage 4 |
UF1 | upper flowers stage 1 |
UF2 | upper flowers stage 2 |
UF3 | upper flowers stage 3 |
UF4 | upper flowers stage 4 |
Annotations of Ll_transcript_270920
Blastp | Serine/threonine-protein kinase BRI1-like 1 from Arabidopsis with 69.61% of identity |
---|---|
Blastx | Serine/threonine-protein kinase BRI1-like 1 from Arabidopsis with 69.61% of identity |
Eggnog | Serine Threonine protein kinase(COG0515) |
Kegg | Link to kegg annotations (AT1G55610) |
CantataDB | - |
Mirbase | - |
Ncbi protein | Link to NCBI protein (XP_004499678.1) |
Pfam | Leucine Rich Repeat (PF00560.32) |
Rfam | - |
GO | Links to GO: General; Genes and gene products; Annotations; Ontology; Links to GO: General; Genes and gene products; Annotations; Ontology; |