Id Trinity | FTRINITY_DN40132_c0_g1_i1 |
---|---|
Name Transcript | Ll_transcript_244110 |
Sequence | AAAAGATTTACTTTTGCAGAAAAACTCTTACCACAGCTGGGTTACCAAAAAAGGGCCCATCTTATGAATCCAATGGTGCCTGGTTTGACAGGGAACAAAA TGTCTTCGTCTGAAGAAGACAGCAAAATAGATCTCCTGGATTCGCCATCTAACGTGAAAAAGAAGCTCAAAAAGGCCTTCTGCGAGCCGGGTAACATCGA GAACAACGGCGTCCTGTCCTTTTCGAAGCACGTAATTTTCCCGCTGCTGAAACCGGAAGAAAAGTTCGTCGTGCCGCGAAAACCGGAAAACGGCGGAGAC TCGTTTTTCGAAACTTTCGAAAAGTTACAGâBLAST |
Tissue | flowers |
Gene name | LI_gene_9097; |
Additional information | details; |
FPAB | abscising flower pedicels |
FPNAB | non-abscising flower pedicels |
LF1 | lower flowers stage 1 |
LF2 | lower flowers stage 2 |
LF3 | lower flowers stage 3 |
LF4 | lower flowers stage 4 |
UF1 | upper flowers stage 1 |
UF2 | upper flowers stage 2 |
UF3 | upper flowers stage 3 |
UF4 | upper flowers stage 4 |
Annotations of Ll_transcript_244110
Blastp | Tyrosine--tRNA ligase, cytoplasmic from Silurana with 71.82% of identity |
---|---|
Blastx | Tyrosine--tRNA ligase, cytoplasmic from Silurana with 71.82% of identity |
Eggnog | Is required not only for elongation of protein synthesis but also for the initiation of all mRNA translation through initiator tRNA(fMet) aminoacylation (By similarity)(COG0073) |
Kegg | Link to kegg annotations (448444) |
CantataDB | - |
Mirbase | - |
Ncbi protein | Link to NCBI protein (XP_004513862.1) |
Pfam | tRNA synthetases class I (W and Y) (PF00579.24) |
Rfam | - |
GO | Links to GO: General; Genes and gene products; Annotations; Ontology; Links to GO: General; Genes and gene products; Annotations; Ontology; |