Ll_transcript_244110

• Id Trinity: FTRINITY_DN40132_c0_g1_i1
• Name Transcript: Ll_transcript_244110
• Sequence: AAAAGATTTACTTTTGCAGAAAAACTCTTACCACAGCTGGGTTACCAAAAAAGGGCCCATCTTATGAATCCAATGGTGCCTGGTTTGACAGGGAACAAAA TGTCTTCGTCTGAAGAAGACAGCAAAATAGATCTCCTGGATTCGCCATCTAACGTGAAAAAGAAGCTCAAAAAGGCCTTCTGCGAGCCGGGTAACATCGA GAACAACGGCGTCCTGTCCTTTTCGAAGCACGTAATTTTCCCGCTGCTGAAACCGGAAGAAAAGTTCGTCGTGCCGCGAAAACCGGAAAACGGCGGAGAC TCGTTTTTCGAAACTTTCGAAAAGTTACAG
• Tissue: flowers
• Gene name: LI_gene_9097;
• Additional information: details;

Expression of Ll_transcript_244110

FPKM

• FPAB: 0
• FPNAB: 0
• LF1: 0
• LF2: 0
• LF3: 1.3
• LF4: 0
• UF1: 0
• UF2: 0
• UF3: 0
• UF4: 0

Labels

• FPAB: abscising flower pedicels
• FPNAB   : non-abscising flower pedicels
• LF1: lower flowers stage 1
• LF2: lower flowers stage 2
• LF3: lower flowers stage 3
• LF4: lower flowers stage 4
• UF1: upper flowers stage 1
• UF2: upper flowers stage 2
• UF3: upper flowers stage 3
• UF4: upper flowers stage 4

Annotations of Ll_transcript_244110

• Blastp: Tyrosine--tRNA ligase, cytoplasmic from Silurana with 71.82% of identity
• Blastx: Tyrosine--tRNA ligase, cytoplasmic from Silurana with 71.82% of identity
• Eggnog: Is required not only for elongation of protein synthesis but also for the initiation of all mRNA translation through initiator tRNA(fMet) aminoacylation (By similarity)(COG0073)
• Kegg: Link to kegg annotations (448444)
• CantataDB: -
• Mirbase: -
• Ncbi protein: Link to NCBI protein (XP_004513862.1)
• Pfam: tRNA synthetases class I (W and Y) (PF00579.24)
• Rfam: -
• GO: Links to GO: General; Genes and gene products; Annotations; Ontology;
  Links to GO: General; Genes and gene products; Annotations; Ontology;