| Id Trinity | FTRINITY_DN41091_c0_g1_i1 |
|---|---|
| Name Transcript | Ll_transcript_262209 |
| Sequence | CAGTCTTCATATAATAACCTTATTTCAAATATTGTTATTGAAATTCCATCAATCAATACTACAGGATTTGATCTGCTTTCTTACGACATACAACGCGGTC GTGATGTCGGTCTTCCGCCCTACACTAAAATGAGAAGTTTATGCGGACTGCCACAAGCAAAGTCATTTGATGATTTATCGGATTACATACCATCAAAAAA AATTGACCAGTTAAAAAATTTCTATTCATCGGTTGACGATATTGATTATTACGTTGGAATTTTATTGGAAGATAAAGTAATCGGATCTATGTTTGGCCCT ACTGGAAGTTGTGTTATTGCTGATAGTTTTTACCGATTTAGAAATGGTGACCGTTTCTTCTACGACGTCAAAGATCAACCTGGTAGCTTCACTTCAGATC AATTACAGTCACTGAAGAAAATAAC BLAST |
| Tissue | flowers |
| Gene name | LI_gene_9394; |
| Additional information | details; |
| FPAB | abscising flower pedicels |
| FPNAB | non-abscising flower pedicels |
| LF1 | lower flowers stage 1 |
| LF2 | lower flowers stage 2 |
| LF3 | lower flowers stage 3 |
| LF4 | lower flowers stage 4 |
| UF1 | upper flowers stage 1 |
| UF2 | upper flowers stage 2 |
| UF3 | upper flowers stage 3 |
| UF4 | upper flowers stage 4 |
Annotations of Ll_transcript_262209
| Blastp | Peroxidase mlt-7 from Caenorhabditis with 45.74% of identity |
|---|---|
| Blastx | Peroxidase mlt-7 from Caenorhabditis with 45.74% of identity |
| Eggnog | prostaglandin G H synthase and cyclooxygenase(ENOG410XPZ3) |
| Kegg | Link to kegg annotations (CELE_ZK430.8) |
| CantataDB | - |
| Mirbase | - |
| Ncbi protein | Link to NCBI protein (XP_013450851.1) |
| Pfam | Animal haem peroxidase (PF03098.14) |
| Rfam | - |
| GO | Links to GO: General; Genes and gene products; Annotations; Ontology; |