| Id Trinity | FTRINITY_DN41296_c0_g1_i1 |
|---|---|
| Name Transcript | Ll_transcript_169321 |
| Sequence | CAAAGAAATACCACAAATGCCTGATGAACAACAAAGCTGGATGTCATTTTTATCAAAAGCTGTTACTGCATCAGCTAATTATTTACCGACTCAAGTAACA GATGTGTTCAACCAGGGACGAGCAGTAGCTTCAATCCATCTACCCTTTCAGGGACTAAAAAATATTTGTACAATAGTGATATATGGAAGAGGGTGGCGAA TGTACTCTTTGGCGTACTCATAGGTTGGATGGCCAATTAGATGTAGTGGATAGCCCTAAACCAATCAAATTGAAGGAGGTCAATACAACCAAGTTGGATA AAACCACGAAAACAGAATCCACCATCAATAAAAAATTAGATGCAG BLAST |
| Tissue | flowers |
| Gene name | LI_gene_9468; |
| Additional information | - |
| FPAB | abscising flower pedicels |
| FPNAB | non-abscising flower pedicels |
| LF1 | lower flowers stage 1 |
| LF2 | lower flowers stage 2 |
| LF3 | lower flowers stage 3 |
| LF4 | lower flowers stage 4 |
| UF1 | upper flowers stage 1 |
| UF2 | upper flowers stage 2 |
| UF3 | upper flowers stage 3 |
| UF4 | upper flowers stage 4 |
Annotations of Ll_transcript_169321
| Blastp | - |
|---|---|
| Blastx | WD repeat domain phosphoinositide-interacting protein 2 from Homo with 51.72% of identity |
| Eggnog | The PI(3,5)P2 regulatory complex regulates both the synthesis and turnover of phosphatidylinositol 3,5-bisphosphate (PtdIns(3,5)P2). Necessary for proper vacuole morphology. Plays an important role in osmotically-induced vacuole fragmentation. Required for cytoplasm to vacuole transport (Cvt) vesicle formation, pexophagy and starvation-induced autophagy. Involved in correct atg9 trafficking to the pre-autophagosomal structure. Might also be involved in premeiotic DNA replication (By similarity)(ENOG410XP6Y) |
| Kegg | Link to kegg annotations (26100) |
| CantataDB | - |
| Mirbase | - |
| Ncbi protein | Link to NCBI protein (XP_019445934.1) |
| Pfam | - |
| Rfam | - |
| GO | Links to GO: General; Genes and gene products; Annotations; Ontology; |