| Id Trinity | FTRINITY_DN41366_c0_g1_i1 |
|---|---|
| Name Transcript | Ll_transcript_160321 |
| Sequence | GTTGGGTGATACTTGCACAAGAGGGTGCAGGTTTTGTTCCATCAAAACATCAAGAAATCCCCCTCCACCTGATCCAAAGGAACCTGTTAATACAGCAACA GCTATAGCAACATGGGGGTTAGATTATGTGGTTTTAACGTCAGTTGATAGAGATGACTTACTAGATGGTGGTTCAATGCATTTTGCAGAAACAGTCAGGG AAATAAAAAGACAGAACTCTGATATTTTGGTGGAATGTTTGGTTCCCGACTTTAGGGGTAATTTGGACCATGTAAAAAACATTGTAGAATGTGGTCTTGA TGTGTATGCACATAATATTGAAACAGTGGGATCATTAACTCTCCTTGTGAGGGATAGGCGTGCACA BLAST |
| Tissue | flowers |
| Gene name | LI_gene_9502; |
| Additional information | details; |
| FPAB | abscising flower pedicels |
| FPNAB | non-abscising flower pedicels |
| LF1 | lower flowers stage 1 |
| LF2 | lower flowers stage 2 |
| LF3 | lower flowers stage 3 |
| LF4 | lower flowers stage 4 |
| UF1 | upper flowers stage 1 |
| UF2 | upper flowers stage 2 |
| UF3 | upper flowers stage 3 |
| UF4 | upper flowers stage 4 |
Annotations of Ll_transcript_160321
| Blastp | Lipoyl synthase, mitochondrial from Sophophora with 78.51% of identity |
|---|---|
| Blastx | Lipoyl synthase, mitochondrial from Sophophora with 78.51% of identity |
| Eggnog | Catalyzes the radical-mediated insertion of two sulfur atoms into the C-6 and C-8 positions of the octanoyl moiety bound to the lipoyl domains of lipoate-dependent enzymes, thereby converting the octanoylated domains into lipoylated derivatives (By similarity)(COG0320) |
| Kegg | Link to kegg annotations (Dmel_CG5231) |
| CantataDB | - |
| Mirbase | - |
| Ncbi protein | Link to NCBI protein (XP_003555873.1) |
| Pfam | Radical SAM superfamily (PF04055.20) |
| Rfam | - |
| GO | Links to GO: General; Genes and gene products; Annotations; Ontology; Links to GO: General; Genes and gene products; Annotations; Ontology; |