Id Trinity | FTRINITY_DN41392_c0_g1_i1 |
---|---|
Name Transcript | Ll_transcript_160322 |
Sequence | CATGTCTAACCAAAAGCAACCAGCTGTTGCCAACTTTGCCACAGCATTCAAAGCCAAGGATCTCAAGAATGCTAGCTCATGGTCTTCCTTAGCCCAGTCA TCATCACCTCAAAACTCTTTTCACAATTCAAATCGTTCATCTGCAATTGACAGTTTCCAGCAATTTAAAAAGCAAGCTAGGAAACAGGCTGATATGCAGC GCCATATCCAGGAGCAACAAGAAATGCGAAGACAACAAAAAGAGCTAGCTGAGAAAGAGCGTATTCGCCAGGAAAATGAACGAAGACGAGGGAAAGAAGA AGAGGAAGâBLAST |
Tissue | flowers |
Gene name | LI_gene_9526; |
Additional information | details; |
FPAB | abscising flower pedicels |
FPNAB | non-abscising flower pedicels |
LF1 | lower flowers stage 1 |
LF2 | lower flowers stage 2 |
LF3 | lower flowers stage 3 |
LF4 | lower flowers stage 4 |
UF1 | upper flowers stage 1 |
UF2 | upper flowers stage 2 |
UF3 | upper flowers stage 3 |
UF4 | upper flowers stage 4 |
Annotations of Ll_transcript_160322
Blastp | Bromodomain-containing protein 4 from Danio with 39.77% of identity |
---|---|
Blastx | - |
Eggnog | bromodomain(COG5076) |
Kegg | Link to kegg annotations (570531) |
CantataDB | - |
Mirbase | - |
Ncbi protein | - |
Pfam | - |
Rfam | - |
GO | Links to GO: General; Genes and gene products; Annotations; Ontology; |