Id Trinity | FTRINITY_DN41504_c0_g2_i1 |
---|---|
Name Transcript | Ll_transcript_165509 |
Sequence | TCTTACGAAATTACATTGGTATTTACAATCATGTCTATATTTATTATAAACGAAAGATTAAAATTTTATGAATTTGAAAATAACCAAACCTATATGTGAT ACATCTTTTTAACACCCCTATTTTTTATATGGTACATTATCATACTAGCTGAACTAAATCGAACACCGTTCGATTTCGGAGAAGGAGAATCAGAATTAGT ATCAGGATTTAATGTTGAATACAGAGGAGTAGGATTCGCCTTTATTTTTATAACAGAGTACGGAATAATCATTCTAG BLAST |
Tissue | flowers |
Gene name | LI_gene_9629; |
Additional information | - |
FPAB | abscising flower pedicels |
FPNAB | non-abscising flower pedicels |
LF1 | lower flowers stage 1 |
LF2 | lower flowers stage 2 |
LF3 | lower flowers stage 3 |
LF4 | lower flowers stage 4 |
UF1 | upper flowers stage 1 |
UF2 | upper flowers stage 2 |
UF3 | upper flowers stage 3 |
UF4 | upper flowers stage 4 |
Annotations of Ll_transcript_165509
Blastp | - |
---|---|
Blastx | NADH-ubiquinone oxidoreductase chain 1 from Ornithorhynchus with 50.54% of identity |
Eggnog | NDH-1 shuttles electrons from NADH, via FMN and iron- sulfur (Fe-S) centers, to quinones in the respiratory chain. The immediate electron acceptor for the enzyme in this species is believed to be ubiquinone. Couples the redox reaction to proton translocation (for every two electrons transferred, four hydrogen ions are translocated across the cytoplasmic membrane), and thus conserves the redox energy in a proton gradient. This subunit may bind ubiquinone (By similarity)(COG1005) |
Kegg | Link to kegg annotations (808708) |
CantataDB | - |
Mirbase | - |
Ncbi protein | Link to NCBI protein (YP_009237623.1) |
Pfam | - |
Rfam | - |
GO | Links to GO: General; Genes and gene products; Annotations; Ontology; |