Id Trinity | FTRINITY_DN41553_c0_g1_i1 |
---|---|
Name Transcript | Ll_transcript_165516 |
Sequence | CGACAATGAAAAACGTCTAATTGTTATTTTAGAAAACGCTCAGTTGGAAACTGTTAAAGTAGGAAAGTCTTTTGAACTATTAAACCCCGATGAACACTCA CATATATTACGAAAACACGGCCGAGCGATAGGAAAATGTAGACCTGACATTTCTCATCAATGCCTATTGATGTTATTCGACAGTCCCCTAAATCGTGCTG GCCTACTTCAAGTGTACATTCACACAGAAAATAATGTTCTTATTGAAATTAATCCTCAAACACGAATCCCTAGAACATTTAAACGTTTCGCTGGACTA BLAST |
Tissue | flowers |
Gene name | LI_gene_9674; |
Additional information | - |
FPAB | abscising flower pedicels |
FPNAB | non-abscising flower pedicels |
LF1 | lower flowers stage 1 |
LF2 | lower flowers stage 2 |
LF3 | lower flowers stage 3 |
LF4 | lower flowers stage 4 |
UF1 | upper flowers stage 1 |
UF2 | upper flowers stage 2 |
UF3 | upper flowers stage 3 |
UF4 | upper flowers stage 4 |
Annotations of Ll_transcript_165516
Blastp | - |
---|---|
Blastx | Ribosomal RNA small subunit methyltransferase NEP1 from Sophophora with 77.55% of identity |
Eggnog | Methyltransferase involved in ribosomal biogenesis. Specifically catalyzes the N1-methylation of the pseudouridine corresponding to position 914 in M.jannaschii 16S rRNA (By similarity)(COG1756) |
Kegg | Link to kegg annotations (Dmel_CG3527) |
CantataDB | - |
Mirbase | - |
Ncbi protein | Link to NCBI protein (XP_003605504.1) |
Pfam | - |
Rfam | - |
GO | Links to GO: General; Genes and gene products; Annotations; Ontology; |