Id Trinity | FTRINITY_DN41576_c0_g2_i1 |
---|---|
Name Transcript | Ll_transcript_165489 |
Sequence | GTTGGATTATGGAAAATGGGAGTTAATTTTACCCCCAAAACCTGATGGTTCCTGCATGGTTCCGCATTTATCGGAAGTCAAGGTCGTGATTGAAAACCAC CATGGTCACAAACTGGATAAACTATCGCCATATGCCACATATGTGGTAGAACCACCAAAAGACCAAGGAACCATATACAAACAAAAAATGTGGAACCCTC CTCAATCAGAGAGGTACTTGTTCAAACATCCAAAAACGCCAAGGCCAAAAAGCCTTCGTATATACGAGTGCCACGTGGGTATTGCAACATCCGAGTTAAA AGTTGGTGATTATGACAACTTCACTGACAATATCCTGCCCAGAATA BLAST |
Tissue | flowers |
Gene name | LI_gene_9700; |
Additional information | details; |
FPAB | abscising flower pedicels |
FPNAB | non-abscising flower pedicels |
LF1 | lower flowers stage 1 |
LF2 | lower flowers stage 2 |
LF3 | lower flowers stage 3 |
LF4 | lower flowers stage 4 |
UF1 | upper flowers stage 1 |
UF2 | upper flowers stage 2 |
UF3 | upper flowers stage 3 |
UF4 | upper flowers stage 4 |
Annotations of Ll_transcript_165489
Blastp | 1,4-alpha-glucan-branching enzyme from Equus with 50% of identity |
---|---|
Blastx | 1,4-alpha-glucan-branching enzyme from Equus with 50% of identity |
Eggnog | Catalyzes the formation of the alpha-1,6-glucosidic linkages in glycogen by scission of a 1,4-alpha-linked oligosaccharide from growing alpha-1,4-glucan chains and the subsequent attachment of the oligosaccharide to the alpha-1,6 position (By similarity)(COG0296) |
Kegg | Link to kegg annotations (100034152) |
CantataDB | - |
Mirbase | - |
Ncbi protein | Link to NCBI protein (XP_014495800.1) |
Pfam | - |
Rfam | - |
GO | Links to GO: General; Genes and gene products; Annotations; Ontology; |