| Id Trinity | FTRINITY_DN41576_c0_g2_i1 |
|---|---|
| Name Transcript | Ll_transcript_165489 |
| Sequence | GTTGGATTATGGAAAATGGGAGTTAATTTTACCCCCAAAACCTGATGGTTCCTGCATGGTTCCGCATTTATCGGAAGTCAAGGTCGTGATTGAAAACCAC CATGGTCACAAACTGGATAAACTATCGCCATATGCCACATATGTGGTAGAACCACCAAAAGACCAAGGAACCATATACAAACAAAAAATGTGGAACCCTC CTCAATCAGAGAGGTACTTGTTCAAACATCCAAAAACGCCAAGGCCAAAAAGCCTTCGTATATACGAGTGCCACGTGGGTATTGCAACATCCGAGTTAAA AGTTGGTGATTATGACAACTTCACTGACAATATCCTGCCCAGAATA BLAST |
| Tissue | flowers |
| Gene name | LI_gene_9700; |
| Additional information | details; |
| FPAB | abscising flower pedicels |
| FPNAB | non-abscising flower pedicels |
| LF1 | lower flowers stage 1 |
| LF2 | lower flowers stage 2 |
| LF3 | lower flowers stage 3 |
| LF4 | lower flowers stage 4 |
| UF1 | upper flowers stage 1 |
| UF2 | upper flowers stage 2 |
| UF3 | upper flowers stage 3 |
| UF4 | upper flowers stage 4 |
Annotations of Ll_transcript_165489
| Blastp | 1,4-alpha-glucan-branching enzyme from Equus with 50% of identity |
|---|---|
| Blastx | 1,4-alpha-glucan-branching enzyme from Equus with 50% of identity |
| Eggnog | Catalyzes the formation of the alpha-1,6-glucosidic linkages in glycogen by scission of a 1,4-alpha-linked oligosaccharide from growing alpha-1,4-glucan chains and the subsequent attachment of the oligosaccharide to the alpha-1,6 position (By similarity)(COG0296) |
| Kegg | Link to kegg annotations (100034152) |
| CantataDB | - |
| Mirbase | - |
| Ncbi protein | Link to NCBI protein (XP_014495800.1) |
| Pfam | - |
| Rfam | - |
| GO | Links to GO: General; Genes and gene products; Annotations; Ontology; |