Ll_transcript_198543

• Id Trinity: FTRINITY_DN41615_c0_g1_i1
• Name Transcript: Ll_transcript_198543
• Sequence: AAAATATGTTAAAAAGTGCACCATTCAGCCGCCTGTATATGTCCCAAATAAGAAGTAAGGCAACATTACCCTGTTTAAAGTTTGAATATAAAGACTTAGA ACCAATCATATCACGGGATATCATGGAAATTCACCACCAAAAACATCACAACACTTATGTAGTAAACTACAATAATACTCTAGATAAATTACAGACTGCT GTAGCAAAAGATGATACAGCAGCAATCATAAGCTTGTCACCTGCACTTAAATTCAATGGCGGTGGTCATATTAATCATTCTATTTTCTGGGATACCCTTA CACCTCATTCGACTAAACCTTCTGATGATTTGAACAAGGCTTTAATCCAAAACTTTGGTTCTTGTGATGAGT
• Tissue: flowers
• Gene name: LI_gene_9740;
• Additional information: details;

Expression of Ll_transcript_198543

FPKM

• FPAB: 0
• FPNAB: 0
• LF1: 0
• LF2: 0
• LF3: 0
• LF4: 0.7
• UF1: 0
• UF2: 0
• UF3: 0
• UF4: 0

Labels

• FPAB: abscising flower pedicels
• FPNAB   : non-abscising flower pedicels
• LF1: lower flowers stage 1
• LF2: lower flowers stage 2
• LF3: lower flowers stage 3
• LF4: lower flowers stage 4
• UF1: upper flowers stage 1
• UF2: upper flowers stage 2
• UF3: upper flowers stage 3
• UF4: upper flowers stage 4

Annotations of Ll_transcript_198543

• Blastp: Superoxide dismutase [Mn], mitochondrial from Sophophora with 56.48% of identity
• Blastx: Superoxide dismutase [Mn], mitochondrial from Sophophora with 56.48% of identity
• Eggnog: Destroys radicals which are normally produced within the cells and which are toxic to biological systems (By similarity)(COG0605)
• Kegg: Link to kegg annotations (Dmel_CG8905)
• CantataDB: -
• Mirbase: -
• Ncbi protein: Link to NCBI protein (XP_003526813.1)
• Pfam: Iron/manganese superoxide dismutases, alpha-hairpin domain (PF00081.21)
• Rfam: -
• GO: Links to GO: General; Genes and gene products; Annotations; Ontology;
  Links to GO: General; Genes and gene products; Annotations; Ontology;