| Id Trinity | FTRINITY_DN41621_c0_g1_i1 |
|---|---|
| Name Transcript | Ll_transcript_198520 |
| Sequence | AAACCGTAGACGTGGTAAAAACGAGAATGAAACCGAGAAGCGTGAATTGGTATTCAAAGAAGATGGCCAAGAATATGCTCAAGTTACCAAAATGTTGGGA AATGGACGTCTAGAAGCTATGTGCTTTGATGGTGTTAAACGACTTTGCCACATTCGAGGAAAACTTAGGAAAAAGGTATGGATCAACCAAGCTGATATAG TATTAATAGGCTTACGTGAATATCAAGATACAAAAGCTGATGTAATTTTGAAGTATACGCCTGATGAAGCTCGTAACTTGAAAACATACGGAGAATTTCC AGAAACTGTTCGCATCAATGATACAGTCACATTTGTTGACGATGGATTGGATGAGGATATTGAATTTGGAG BLAST |
| Tissue | flowers |
| Gene name | LI_gene_9746; |
| Additional information | details; |
| FPAB | abscising flower pedicels |
| FPNAB | non-abscising flower pedicels |
| LF1 | lower flowers stage 1 |
| LF2 | lower flowers stage 2 |
| LF3 | lower flowers stage 3 |
| LF4 | lower flowers stage 4 |
| UF1 | upper flowers stage 1 |
| UF2 | upper flowers stage 2 |
| UF3 | upper flowers stage 3 |
| UF4 | upper flowers stage 4 |
Annotations of Ll_transcript_198520
| Blastp | Eukaryotic translation initiation factor 1A, X-chromosomal from Pongo with 79.51% of identity |
|---|---|
| Blastx | Eukaryotic translation initiation factor 1A, X-chromosomal from Pongo with 79.51% of identity |
| Eggnog | however, it seems to stimulate more or less all the activities of the other two initiation factors, IF-2 and IF-3 (By similarity)(COG0361) |
| Kegg | Link to kegg annotations (100172735) |
| CantataDB | - |
| Mirbase | - |
| Ncbi protein | Link to NCBI protein (XP_003548603.1) |
| Pfam | Translation initiation factor 1A / IF-1 (PF01176.18) |
| Rfam | - |
| GO | Links to GO: General; Genes and gene products; Annotations; Ontology; Links to GO: General; Genes and gene products; Annotations; Ontology; |