| Id Trinity | FTRINITY_DN41644_c0_g1_i1 |
|---|---|
| Name Transcript | Ll_transcript_198551 |
| Sequence | GGTTAGCAAAATCGTGTCAATTTGTATCAAAATATTATATTGCAGCAAAAAAGAATCTAGAAAAGAGTAAATCAGTTATTGATGAAGGTGTAAAATGGTC AAAGCATGCCTTGGAAATGTATCCAGGGAATTGCAATGCACACAAATGGTTTGCTATATGTAGTGGTGCTCGAGGTCAGTTAGGATCAACTAAAGAAAAA ATTGAAGGAGGTTATATATTTCAAAATCACATAAATGAAGCAATAAAAATCAATTCTCGTGATCCAACTTTATATTATTTAAAAGGAAAACTTGAATATG AAGTTGCTGTTTTATCATCTTTTGACCGGCGTATAGCTAGTTGGTTGTATGGAGAGA BLAST |
| Tissue | flowers |
| Gene name | LI_gene_9761; |
| Additional information | details; |
| FPAB | abscising flower pedicels |
| FPNAB | non-abscising flower pedicels |
| LF1 | lower flowers stage 1 |
| LF2 | lower flowers stage 2 |
| LF3 | lower flowers stage 3 |
| LF4 | lower flowers stage 4 |
| UF1 | upper flowers stage 1 |
| UF2 | upper flowers stage 2 |
| UF3 | upper flowers stage 3 |
| UF4 | upper flowers stage 4 |
Annotations of Ll_transcript_198551
| Blastp | Regulator of microtubule dynamics protein 1 from Bos with 38.78% of identity |
|---|---|
| Blastx | Regulator of microtubule dynamics protein 1 from Bos with 38.78% of identity |
| Eggnog | Family with sequence similarity 82, member B(ENOG410ZMYH) |
| Kegg | Link to kegg annotations (513788) |
| CantataDB | - |
| Mirbase | - |
| Ncbi protein | Link to NCBI protein (XP_003613573.2) |
| Pfam | - |
| Rfam | - |
| GO | Links to GO: General; Genes and gene products; Annotations; Ontology; |