| Id Trinity | FTRINITY_DN41684_c0_g1_i1 |
|---|---|
| Name Transcript | Ll_transcript_198547 |
| Sequence | AGAAGAAAATGTTCAAGGTCCGGGTATAGTAGCAAACAAAAAACAATTGAGGGCCTATGTAGGCACAAACACGGAGCTGCGTTGCCAACCTCAAGACCCC AACGCAAGAATCAAATGGTACAGAGAATCCAGAGTTTTGCCGATTAATTCCAGAGTAGACAGAGGTTCCTTGACCCTGTACAACGTTCAGCCGGAAGATG GCGGCAGATATTACTGCGAAATCGAAGGCGAACAATCCAACGATTTCACCGACTTGATCâBLAST |
| Tissue | flowers |
| Gene name | LI_gene_9799; |
| Additional information | - |
| FPAB | abscising flower pedicels |
| FPNAB | non-abscising flower pedicels |
| LF1 | lower flowers stage 1 |
| LF2 | lower flowers stage 2 |
| LF3 | lower flowers stage 3 |
| LF4 | lower flowers stage 4 |
| UF1 | upper flowers stage 1 |
| UF2 | upper flowers stage 2 |
| UF3 | upper flowers stage 3 |
| UF4 | upper flowers stage 4 |
Annotations of Ll_transcript_198547
| Blastp | - |
|---|---|
| Blastx | Down syndrome cell adhesion molecule from Homo with 37.18% of identity |
| Eggnog | down syndrome cell adhesion molecule(ENOG410XQX7) |
| Kegg | Link to kegg annotations (1826) |
| CantataDB | - |
| Mirbase | - |
| Ncbi protein | Link to NCBI protein (XP_003552840.1) |
| Pfam | - |
| Rfam | - |
| GO | Links to GO: General; Genes and gene products; Annotations; Ontology; |