Ll_transcript_170163

• Id Trinity: FTRINITY_DN41772_c0_g1_i1
• Name Transcript: Ll_transcript_170163
• Sequence: GTTATACTAATAATATACTCTAACCAAAGTTTAAAATTATGGGAGTTCATAAACGTGTTCCAGGAATCATTTCCTTGCTCTTTCTAATTTCTGTGTTATT GGAATTCAATGTTGTTTATTCCTACACTCGTCCACCTCCTCGTAACAACATTTTGTCCGATATTGATCCCTCAGATCCACAACAGGTACGTATAGCTAAA GTAGGGAAAGATAGAATGAGAATATCATGGTTTACAATTTATCCAACCCCTGCAACAGTTCAATATGGTCTAACCCGTTCGGCTGATACCTTCAATGCCA CTGGAGTGATTGATTCATATCATTATATACTATATTATTCTGGACCAGTTCATAATGTGGTAATAGGTCCACTCAAACCTAATAGAGTTTACTACTATCG TATGGGTGAATCTACCAAAGTATACAATTTCAAAACTGCAC
• Tissue: flowers
• Gene name: LI_gene_9884;
• Additional information: details;

Expression of Ll_transcript_170163

FPKM

• FPAB: 0
• FPNAB: 0
• LF1: 0.8
• LF2: 0
• LF3: 0
• LF4: 0.2
• UF1: 0
• UF2: 0
• UF3: 0.1
• UF4: 0

Labels

• FPAB: abscising flower pedicels
• FPNAB   : non-abscising flower pedicels
• LF1: lower flowers stage 1
• LF2: lower flowers stage 2
• LF3: lower flowers stage 3
• LF4: lower flowers stage 4
• UF1: upper flowers stage 1
• UF2: upper flowers stage 2
• UF3: upper flowers stage 3
• UF4: upper flowers stage 4

Annotations of Ll_transcript_170163

• Blastp: Probable purple acid phosphatase 20 from Arabidopsis with 42.22% of identity
• Blastx: Probable purple acid phosphatase 20 from Arabidopsis with 45.22% of identity
• Eggnog: Hydrolyzes cAMP to 5'-AMP. Plays an important regulatory role in modulating the intracellular concentration of cAMP, thereby influencing cAMP-dependent processes (By similarity)(COG1409)
• Kegg: Link to kegg annotations (AT3G52780)
• CantataDB: -
• Mirbase: -
• Ncbi protein: Link to NCBI protein (XP_019442476.1)
• Pfam: Purple acid Phosphatase, N-terminal domain (PF16656.4)
• Rfam: -
• GO: Links to GO: General; Genes and gene products; Annotations; Ontology;
  Links to GO: General; Genes and gene products; Annotations; Ontology;