Id Trinity | FTRINITY_DN41843_c0_g2_i1 |
---|---|
Name Transcript | Ll_transcript_239443 |
Sequence | CTCAATTCCTCTAATTTAACTATGAATCCATTTTTCACCATCCCTCTATTCTTTTTCATCATTCTCTCTCTCACACCCTCCTATGGGTACGATTCCTTGG ATCCATATGGAAACATCACCGTCACATGGGATTTCTTGGCTGATAACGGGGACACAGTCGATGTGAAGGTATCAATATACAACTTCCAACTATTTCGGCA CGTGGAGCAACCAGGTTGGAGATTGGGATGGGCATGGACAGGTGATGAGGTGATATGGGCAATGTTGGGAGCAGAAGCAACAGAGCAAGGGAATTGCACT AGATTCAGAGGACA BLAST |
Tissue | flowers |
Gene name | LI_gene_9947; |
Additional information | details; |
FPAB | abscising flower pedicels |
FPNAB | non-abscising flower pedicels |
LF1 | lower flowers stage 1 |
LF2 | lower flowers stage 2 |
LF3 | lower flowers stage 3 |
LF4 | lower flowers stage 4 |
UF1 | upper flowers stage 1 |
UF2 | upper flowers stage 2 |
UF3 | upper flowers stage 3 |
UF4 | upper flowers stage 4 |
Annotations of Ll_transcript_239443
Blastp | COBRA-like protein 1 from Arabidopsis with 52.13% of identity |
---|---|
Blastx | COBRA-like protein 2 from Arabidopsis with 56.58% of identity |
Eggnog | cobra-like protein(ENOG410YAAC) |
Kegg | Link to kegg annotations (AT3G02210) |
CantataDB | - |
Mirbase | - |
Ncbi protein | Link to NCBI protein (XP_019418461.1) |
Pfam | COBRA-like protein (PF04833.14) |
Rfam | - |
GO | Links to GO: General; Genes and gene products; Annotations; Ontology; Links to GO: General; Genes and gene products; Annotations; Ontology; |