| Id Trinity | FTRINITY_DN43030_c0_g1_i1 |
|---|---|
| Name Transcript | Ll_transcript_269907 |
| Sequence | TGCATTCAAGGAATTGGATAAGCTTTATGGCACCTGGAAGTCCTCTTCCAAGGTCAAGAAGGGCTACAACTTGCCCATGCCTAAGATGGGCAACACTGAC CTTACCAGGCTTCTCAAGTCTGAGGAAATCAGGAAGGTCCTGAGGCCTGCGGTCACCAAGGTCATCCGCCGTGTGAAGAAGCACAACCCTCTTAGCAACC AGCGTGCAATGTTGAAACTGAACCCCTATGCTGCTGTTCTCAAGAGGAATGCCATC BLAST |
| Tissue | flowers |
| Gene name | LI_gene_10982; |
| Additional information | - |
| FPAB | abscising flower pedicels |
| FPNAB | non-abscising flower pedicels |
| LF1 | lower flowers stage 1 |
| LF2 | lower flowers stage 2 |
| LF3 | lower flowers stage 3 |
| LF4 | lower flowers stage 4 |
| UF1 | upper flowers stage 1 |
| UF2 | upper flowers stage 2 |
| UF3 | upper flowers stage 3 |
| UF4 | upper flowers stage 4 |
Annotations of Ll_transcript_269907
| Blastp | - |
|---|---|
| Blastx | 60S ribosomal protein L4 from Sophophora with 65.48% of identity |
| Eggnog | One of the primary rRNA binding proteins, this protein initially binds near the 5'-end of the 23S rRNA. It is important during the early stages of 50S assembly. It makes multiple contacts with different domains of the 23S rRNA in the assembled 50S subunit and ribosome (By similarity)(COG0088) |
| Kegg | Link to kegg annotations (Dmel_CG5502) |
| CantataDB | - |
| Mirbase | - |
| Ncbi protein | Link to NCBI protein (XP_003554356.1) |
| Pfam | - |
| Rfam | - |
| GO | Links to GO: General; Genes and gene products; Annotations; Ontology; |