Id Trinity | FTRINITY_DN43247_c0_g1_i2 |
---|---|
Name Transcript | Ll_transcript_195110 |
Sequence | GTTCGTTACTGCATCAAAAGATAAAACATCAAAATTATTTGATGTTGATGATTTATCGGTCCATAAAGTTTATGTGACTGAACGACCTGTCAACAGTGCT TCACTTTCACCTAAATATGATCATGTTGTATTGGGTGGTGGTCAAGATGCTATGGATGTAACAACAACAGCAGCACAAGCAGGAAAATTCGATGCTAGAT TCTTTCATGTAATTTTTGAAGAAGAATTTGCAAGAGTGAAAGGTCATTTTGGTCCCATAAATTCATTAGCATTCCATCCAGATGGTGAAAGTTTCAGTAC TGGCGGAGAGGATGGTTTCATTAGGGTACAGTCATTCGATCCAAC BLAST |
Tissue | flowers |
Gene name | LI_gene_11196; |
Additional information | details; |
FPAB | abscising flower pedicels |
FPNAB | non-abscising flower pedicels |
LF1 | lower flowers stage 1 |
LF2 | lower flowers stage 2 |
LF3 | lower flowers stage 3 |
LF4 | lower flowers stage 4 |
UF1 | upper flowers stage 1 |
UF2 | upper flowers stage 2 |
UF3 | upper flowers stage 3 |
UF4 | upper flowers stage 4 |
Annotations of Ll_transcript_195110
Blastp | Eukaryotic translation initiation factor 3 subunit I from Hawaiian Drosophila with 76.11% of identity |
---|---|
Blastx | Eukaryotic translation initiation factor 3 subunit I from Hawaiian Drosophila with 76.11% of identity |
Eggnog | Component of the eukaryotic translation initiation factor 3 (eIF-3) complex, which is involved in protein synthesis and, together with other initiation factors, stimulates binding of mRNA and methionyl-tRNAi to the 40S ribosome (By similarity)(ENOG410XQ3E) |
Kegg | Link to kegg annotations (Dgri_GH10244) |
CantataDB | - |
Mirbase | - |
Ncbi protein | Link to NCBI protein (XP_004492932.1) |
Pfam | WD domain, G-beta repeat (PF00400.31) |
Rfam | - |
GO | Links to GO: General; Genes and gene products; Annotations; Ontology; Links to GO: General; Genes and gene products; Annotations; Ontology; |