| Id Trinity | FTRINITY_DN43297_c0_g1_i1 |
|---|---|
| Name Transcript | Ll_transcript_195164 |
| Sequence | GTTTCGTAGCCGGCCGCCGTGCGTTCAGTCTGTCAATTTTTTTTATCATCATCTGCGGAACGCGTCTCACGTCGCAGTCGCCGTCGCTCGCTCACTCCGC ACTCGCAGTTCGCACCCGTACTCACTCACACACACACACATACACTCACACACACTCACTCGCAGCACACACGCAAACTCGCGCGCGCCGCTCTCGCCTG GTTGGATTTATCTATTTTCCACGCGCCCGCGAGTCCGAACCTAGTCGGCCGCGCCGTACACGTCTCAGCGTCAACCGACCGACACAGCCTTTAGCGCCCG ACCGCCGTCGCAAGTCGCTGTTTGGATTTTCGTCGTCCGTCACCCTACGTACCCGGCACAATCATGAGCACCTTAGCGGAGACAAATCCGATTTACGGGC CGTTCTTCGGCGTCATGGGCGCGGCATCGGCCATCATATTCAGCGCTCTTGGCGCTGCATACGGTACCGCAAAATCTGGAACCGGTATTGCCGCCATGTC AGTAATGAGGCCAGAACTTATTATGAAATCCATCATTCCCGTTGTCATGGCTGGTATTATTGCTATATATGGTCTCGTAGTAGCTGTCCTAATAGCAGGA GCTCTGGAAGAGCCATCTAAATACTCCTTGTTCAAGGGATTCATTCATCTTGGTGCTGGCCTTTCCGTAGGCTTCAGTGGTTTGGCTGCCGGATTCGCAA TTGGTATTGTTGGCGATGCTGGTGTCAGAGGCACGGCCCAACAGCCCAGATTATTCGTAGGAATGATCTTGATCCTAATTTTCGCAGAAGTATTGGGATT GTACGGACTGATTGTTGCAATTTACCTATACACAAAATAAACAATTTTCCC BLAST |
| Tissue | flowers |
| Gene name | LI_gene_11247; |
| Additional information | details; |
| FPAB | abscising flower pedicels |
| FPNAB | non-abscising flower pedicels |
| LF1 | lower flowers stage 1 |
| LF2 | lower flowers stage 2 |
| LF3 | lower flowers stage 3 |
| LF4 | lower flowers stage 4 |
| UF1 | upper flowers stage 1 |
| UF2 | upper flowers stage 2 |
| UF3 | upper flowers stage 3 |
| UF4 | upper flowers stage 4 |
Annotations of Ll_transcript_195164
| Blastp | V-type proton ATPase 16 kDa proteolipid subunit from Sophophora with 94.9% of identity |
|---|---|
| Blastx | V-type proton ATPase 16 kDa proteolipid subunit from Sophophora with 94.9% of identity |
| Eggnog | F(1)F(0) ATP synthase produces ATP from ADP in the presence of a proton or sodium gradient. F-type ATPases consist of two structural domains, F(1) containing the extramembraneous catalytic core and F(0) containing the membrane proton channel, linked together by a central stalk and a peripheral stalk. During catalysis, ATP synthesis in the catalytic domain of F(1) is coupled via a rotary mechanism of the central stalk subunits to proton translocation (By similarity)(COG0636) |
| Kegg | Link to kegg annotations (Dmel_CG3161) |
| CantataDB | - |
| Mirbase | - |
| Ncbi protein | Link to NCBI protein (XP_003517187.1) |
| Pfam | ATP synthase subunit C (PF00137.20) |
| Rfam | - |
| GO | Links to GO: General; Genes and gene products; Annotations; Ontology; Links to GO: General; Genes and gene products; Annotations; Ontology; |