Id Trinity | FTRINITY_DN43297_c0_g1_i1 |
---|---|
Name Transcript | Ll_transcript_195164 |
Sequence | GTTTCGTAGCCGGCCGCCGTGCGTTCAGTCTGTCAATTTTTTTTATCATCATCTGCGGAACGCGTCTCACGTCGCAGTCGCCGTCGCTCGCTCACTCCGC ACTCGCAGTTCGCACCCGTACTCACTCACACACACACACATACACTCACACACACTCACTCGCAGCACACACGCAAACTCGCGCGCGCCGCTCTCGCCTG GTTGGATTTATCTATTTTCCACGCGCCCGCGAGTCCGAACCTAGTCGGCCGCGCCGTACACGTCTCAGCGTCAACCGACCGACACAGCCTTTAGCGCCCG ACCGCCGTCGCAAGTCGCTGTTTGGATTTTCGTCGTCCGTCACCCTACGTACCCGGCACAATCATGAGCACCTTAGCGGAGACAAATCCGATTTACGGGC CGTTCTTCGGCGTCATGGGCGCGGCATCGGCCATCATATTCAGCGCTCTTGGCGCTGCATACGGTACCGCAAAATCTGGAACCGGTATTGCCGCCATGTC AGTAATGAGGCCAGAACTTATTATGAAATCCATCATTCCCGTTGTCATGGCTGGTATTATTGCTATATATGGTCTCGTAGTAGCTGTCCTAATAGCAGGA GCTCTGGAAGAGCCATCTAAATACTCCTTGTTCAAGGGATTCATTCATCTTGGTGCTGGCCTTTCCGTAGGCTTCAGTGGTTTGGCTGCCGGATTCGCAA TTGGTATTGTTGGCGATGCTGGTGTCAGAGGCACGGCCCAACAGCCCAGATTATTCGTAGGAATGATCTTGATCCTAATTTTCGCAGAAGTATTGGGATT GTACGGACTGATTGTTGCAATTTACCTATACACAAAATAAACAATTTTCCC BLAST |
Tissue | flowers |
Gene name | LI_gene_11247; |
Additional information | details; |
FPAB | abscising flower pedicels |
FPNAB | non-abscising flower pedicels |
LF1 | lower flowers stage 1 |
LF2 | lower flowers stage 2 |
LF3 | lower flowers stage 3 |
LF4 | lower flowers stage 4 |
UF1 | upper flowers stage 1 |
UF2 | upper flowers stage 2 |
UF3 | upper flowers stage 3 |
UF4 | upper flowers stage 4 |
Annotations of Ll_transcript_195164
Blastp | V-type proton ATPase 16 kDa proteolipid subunit from Sophophora with 94.9% of identity |
---|---|
Blastx | V-type proton ATPase 16 kDa proteolipid subunit from Sophophora with 94.9% of identity |
Eggnog | F(1)F(0) ATP synthase produces ATP from ADP in the presence of a proton or sodium gradient. F-type ATPases consist of two structural domains, F(1) containing the extramembraneous catalytic core and F(0) containing the membrane proton channel, linked together by a central stalk and a peripheral stalk. During catalysis, ATP synthesis in the catalytic domain of F(1) is coupled via a rotary mechanism of the central stalk subunits to proton translocation (By similarity)(COG0636) |
Kegg | Link to kegg annotations (Dmel_CG3161) |
CantataDB | - |
Mirbase | - |
Ncbi protein | Link to NCBI protein (XP_003517187.1) |
Pfam | ATP synthase subunit C (PF00137.20) |
Rfam | - |
GO | Links to GO: General; Genes and gene products; Annotations; Ontology; Links to GO: General; Genes and gene products; Annotations; Ontology; |