Id Trinity | FTRINITY_DN43329_c0_g1_i1 |
---|---|
Name Transcript | Ll_transcript_271291 |
Sequence | CAAGAACCATGGAAGAGAGCCATATGAACTTACGAAATGGAAGCCTTGAAAGCCATTGTTTAAAGACGAATAACAACATCAATAACAACATCAAAGAACA AGATCACTTTCTCCCTATAGCAAATGTAGGTAGGATCATGAAAAAGGGCATTCCTGGAAATGGAAAAATCTCAAAGGATGCAAAAGAATCAGCTCAAGAA TATGTATCTGAGTTCATAAGCTTTGTCACTGGTGAAGCATCAGATAAATGTCAAAGAGAAAATAGAAAGACCATTAATGGAGATGATATCATATGGGCTA TTACAACTTTAGGGTTTGAAAATTATGTGGAACCCTTAAAGTTCTATCTCCACAAATATAGAGAGATAGAAGGTGAGAAGCTTAATATTCCAAAGCAACA ACAACAACCACATTATCAAGAACAATACCAACAACAAGATCAAATTAATAATGTACCTTTGAGTAGTGTATATTCATCAACACATCTCATTCATCAGCCT CAATATGTTCCTACAGACCAATTATTTTCGCTACCATTTTCCTCAAATTCAATCCAGAAACCATTGCAATCTCAAGACCAGGTTGATTCTATGGGGCAAT GGTAAGAGTAAGACTTGGATTTTATGTTGGTCAAGTTTTCATTTTACATTATTAATGGTGATTCTATATATAGTTATGGTTATATATGAAATGTTATTAA CATGAGTTATGTTATATGTACAACATGATTATATAATTTTCCCTTACAACAAATAAAATTACCTCCCA BLAST |
Tissue | flowers |
Gene name | LI_gene_11284; |
Additional information | details; |
FPAB | abscising flower pedicels |
FPNAB | non-abscising flower pedicels |
LF1 | lower flowers stage 1 |
LF2 | lower flowers stage 2 |
LF3 | lower flowers stage 3 |
LF4 | lower flowers stage 4 |
UF1 | upper flowers stage 1 |
UF2 | upper flowers stage 2 |
UF3 | upper flowers stage 3 |
UF4 | upper flowers stage 4 |
Annotations of Ll_transcript_271291
Blastp | Nuclear transcription factor Y subunit B-7 from Arabidopsis with 63.54% of identity |
---|---|
Blastx | Nuclear transcription factor Y subunit B-7 from Arabidopsis with 61.62% of identity |
Eggnog | Core component of nucleosome. Nucleosomes wrap and compact DNA into chromatin, limiting DNA accessibility to the cellular machineries which require DNA as a template. Histones thereby play a central role in transcription regulation, DNA repair, DNA replication and chromosomal stability. DNA accessibility is regulated via a complex set of post-translational modifications of histones, also called histone code, and nucleosome remodeling(COG2036) |
Kegg | Link to kegg annotations (AT2G13570) |
CantataDB | - |
Mirbase | - |
Ncbi protein | Link to NCBI protein (XP_019414736.1) |
Pfam | Histone-like transcription factor (CBF/NF-Y) and archaeal histone (PF00808.22) |
Rfam | - |
GO | Links to GO: General; Genes and gene products; Annotations; Ontology; |