Ll_transcript_45884

• Id Trinity: FTRINITY_DN43411_c0_g2_i1
• Name Transcript: Ll_transcript_45884
• Sequence: CAACATACTGACCAATCTAGAAACTGTAACTGGGGATGATTTGAAAGTTTTAACTGTGAACCAAATTAAAAAGGTCAGAACCGCCATAGATGAGGCCATA GTAAAAAACGACAATGACTTACTGAAAACCGAAAAAGATCGTAATGAAGCTTTGAAAGAAATAGGCAACCATCTACACGAATCAGTACCAGTCGATGACG ATGAAGATCACAATAAAGTGGAGAGAACTTTTGGCGATTGCG
• Tissue: flowers
• Gene name: LI_gene_11375;
• Additional information: -

Expression of Ll_transcript_45884

FPKM

• FPAB: 0
• FPNAB: 0
• LF1: 0
• LF2: 0
• LF3: 1.6
• LF4: 0
• UF1: 0
• UF2: 0
• UF3: 0
• UF4: 0

Labels

• FPAB: abscising flower pedicels
• FPNAB   : non-abscising flower pedicels
• LF1: lower flowers stage 1
• LF2: lower flowers stage 2
• LF3: lower flowers stage 3
• LF4: lower flowers stage 4
• UF1: upper flowers stage 1
• UF2: upper flowers stage 2
• UF3: upper flowers stage 3
• UF4: upper flowers stage 4

Annotations of Ll_transcript_45884

• Blastp: -
• Blastx: Serine--tRNA ligase, cytoplasmic from Danio with 61.04% of identity
• Eggnog: Catalyzes the attachment of serine to tRNA(Ser). Is also able to aminoacylate tRNA(Sec) with serine, to form the misacylated tRNA L-seryl-tRNA(Sec), which will be further converted into selenocysteinyl-tRNA(Sec) (By similarity)(COG0172)
• Kegg: Link to kegg annotations (445405)
• CantataDB: -
• Mirbase: -
• Ncbi protein: Link to NCBI protein (XP_019419671.1)
• Pfam: -
• Rfam: -
• GO: Links to GO: General; Genes and gene products; Annotations; Ontology;