| Id Trinity | FTRINITY_DN43421_c0_g1_i1 |
|---|---|
| Name Transcript | Ll_transcript_45863 |
| Sequence | CTTCCTTTGTTTCATGGGAAATCTCCTATTCATAATTTTCTTTGCCATGACATTGGCCAACATGGTAGTGTCGAAGCAATTTTCAACTTTTCCTCATGGT ACACTTGACACTACACCTAAAAAATGTAATGGCTTGTTGGGAGAGTGTTTACATGAAGAAGAAAACTCTATGGAGTCTACAATGATAAAAAGAAGAATAC TAGAAACAGAAAGATACATAAGTTATGATGCTCTTGAAAAAGATAACCATCCATGCAACAATCGTGGACAATCTTACTATGGTTGTGGAAGATCTGAGCA GGCTAACCCTTACTACCGTGGCTGCACCGTCATTACACATTGTGCTAGGGATACAAGCTAGATCAATGACTATATAGCAACATAGTAGTATAAATGGTCC TGGTTAGCAATTTACATGTAGTGAAATATGACTTTGCCCCTGTTTATTAATCTTTCATCGGTAGATCAATG BLAST |
| Tissue | flowers |
| Gene name | LI_gene_11386; |
| Additional information | details; |
| FPAB | abscising flower pedicels |
| FPNAB | non-abscising flower pedicels |
| LF1 | lower flowers stage 1 |
| LF2 | lower flowers stage 2 |
| LF3 | lower flowers stage 3 |
| LF4 | lower flowers stage 4 |
| UF1 | upper flowers stage 1 |
| UF2 | upper flowers stage 2 |
| UF3 | upper flowers stage 3 |
| UF4 | upper flowers stage 4 |
Annotations of Ll_transcript_45863
| Blastp | Protein RALF-like 33 from Arabidopsis with 51.72% of identity |
|---|---|
| Blastx | Protein RALF-like 33 from Arabidopsis with 55.7% of identity |
| Eggnog | Cell signaling peptide that may regulate plant stress, growth, and development. Mediates a rapid alkalinization of extracellular space by mediating a transient increase in the cytoplasmic Ca(2 ) concentration leading to a calcium-dependent signaling events through a cell surface receptor and a concomitant activation of some intracellular mitogen-activated protein kinases (By similarity)(ENOG410Z3VJ) |
| Kegg | Link to kegg annotations (AT4G15800) |
| CantataDB | - |
| Mirbase | - |
| Ncbi protein | Link to NCBI protein (XP_004495709.1) |
| Pfam | Rapid ALkalinization Factor (RALF) (PF05498.10) |
| Rfam | - |
| GO | Links to GO: General; Genes and gene products; Annotations; Ontology; |