| Id Trinity | FTRINITY_DN43635_c0_g2_i1 |
|---|---|
| Name Transcript | Ll_transcript_236004 |
| Sequence | CTCGATTTTCTGGAGGCGGAGGCCGTGGTGGTTTTGGTGGTGGTGGTCGTGGTGGCGGCGGTGGCCGGGGAGGTGGCGGTGGTTTCCGTGGACGAGGTGC TGGTGGTCGTGGTGGAGGTGGCCGAGGTGGTGGTGGAAGGCCATCTGGAGGACCTGGAGGCTTCAAAGGCGGTAAAAAAGTTATAATTGAGCCTCATCGT CATGCTGGAGTCTTTGTTGCCCGTGGCAAAGAAGATGCACTTGTCACCAAAAACATGATTCCTGGAGAAACCATCTATGGTGAAAAGAGAATTAGTGTTG ATCAGACTGAAGGAGACAAAATTGAATACCGTGTATGGAATCCGTTCAGATCAAAATTAGCTGCTGCTATATTAGGTGGTATTGATGAAATCCATATGCC ACCTGGATCTAAAGTATTATAT BLAST |
| Tissue | flowers |
| Gene name | LI_gene_11606; |
| Additional information | details; |
| FPAB | abscising flower pedicels |
| FPNAB | non-abscising flower pedicels |
| LF1 | lower flowers stage 1 |
| LF2 | lower flowers stage 2 |
| LF3 | lower flowers stage 3 |
| LF4 | lower flowers stage 4 |
| UF1 | upper flowers stage 1 |
| UF2 | upper flowers stage 2 |
| UF3 | upper flowers stage 3 |
| UF4 | upper flowers stage 4 |
Annotations of Ll_transcript_236004
| Blastp | Probable mediator of RNA polymerase II transcription subunit 36b from Arabidopsis with 74.71% of identity |
|---|---|
| Blastx | rRNA 2'-O-methyltransferase fibrillarin from Schizosaccharomyces with 74.39% of identity |
| Eggnog | Involved in pre-rRNA and tRNA processing. Utilizes the methyl donor S-adenosyl-L-methionine to catalyze the site-specific 2'-hydroxyl methylation of ribose moieties in rRNA and tRNA. Site specificity is provided by a guide RNA that base pairs with the substrate. Methylation occurs at a characteristic distance from the sequence involved in base pairing with the guide RNA (By similarity)(COG1889) |
| Kegg | Link to kegg annotations (AT5G52470) |
| CantataDB | - |
| Mirbase | - |
| Ncbi protein | Link to NCBI protein (XP_013452174.1) |
| Pfam | Fibrillarin (PF01269.16) |
| Rfam | - |
| GO | Links to GO: General; Genes and gene products; Annotations; Ontology; Links to GO: General; Genes and gene products; Annotations; Ontology; |