Id Trinity | FTRINITY_DN43774_c0_g1_i1 |
---|---|
Name Transcript | Ll_transcript_3352 |
Sequence | ATCTTGGCCGTGCTCACCTTGTGGTACGGACTCGCCAAAGCCGAAAACCAACAACTTGACATCCAAAACAAATACTTCAACACTCCAACTGTGAGGCTCG GACTCTTGGCCGGAGTTCTCTTGCTTCAAATGTACTTGGTATTCAATGTTATCAGCAAGGAGATGGCAAAATCTCGCGAGAGCAAATCGTTGACAACAGT GTCCAAGAACAAGACACAGAAAAAAGAAAAGTCGAAGAAAAATAAGAAAGGCGCCAGCGAGGAGTCAGACCTCCCTGAAGTCGACCAAAACACCAACAAA AC BLAST |
Tissue | flowers |
Gene name | LI_gene_11752; |
Additional information | details; |
FPAB | abscising flower pedicels |
FPNAB | non-abscising flower pedicels |
LF1 | lower flowers stage 1 |
LF2 | lower flowers stage 2 |
LF3 | lower flowers stage 3 |
LF4 | lower flowers stage 4 |
UF1 | upper flowers stage 1 |
UF2 | upper flowers stage 2 |
UF3 | upper flowers stage 3 |
UF4 | upper flowers stage 4 |
Annotations of Ll_transcript_3352
Blastp | Translocating chain-associated membrane protein 1-like 1 from Xenopus with 36.14% of identity |
---|---|
Blastx | Translocating chain-associated membrane protein 1-like 1 from Xenopus with 39.68% of identity |
Eggnog | - |
Kegg | Link to kegg annotations (446460) |
CantataDB | - |
Mirbase | - |
Ncbi protein | - |
Pfam | - |
Rfam | - |
GO | Links to GO: General; Genes and gene products; Annotations; Ontology; |