| Id Trinity | FTRINITY_DN43874_c0_g1_i1 |
|---|---|
| Name Transcript | Ll_transcript_95197 |
| Sequence | AGCTTCAGTTGTTTAGAGGAGATACAGTTCTTCTGAAGGGTAAACGAAGAAAAGAAACTGTATGTATTGTCTTGGCCGATGAGACTGTACCTGATGAAAA GATCCGCATGAACCGTGTAGTGCGCAACAACCTGAGAGTTCGCCTGTCTGATGTAGTCTCAGTCCAGCCGTGTCCTGATGTCAAATATGGCAAGAGAATT CATGTACTCCCCATTGATGACACCGTTGAAGGCTTGACTGGCAACCTGTTTGAAGTTTACCTAAAGCCGTATTTCCTAGAAGCCTACAGGCCCATCCATA AAGATGATGCTTTCATTGTCCGAGGTGGTATGAGAGCTGTAGAATTTAAAGTGGTTGAGACAGATCCT BLAST |
| Tissue | flowers |
| Gene name | LI_gene_11852; |
| Additional information | details; |
| FPAB | abscising flower pedicels |
| FPNAB | non-abscising flower pedicels |
| LF1 | lower flowers stage 1 |
| LF2 | lower flowers stage 2 |
| LF3 | lower flowers stage 3 |
| LF4 | lower flowers stage 4 |
| UF1 | upper flowers stage 1 |
| UF2 | upper flowers stage 2 |
| UF3 | upper flowers stage 3 |
| UF4 | upper flowers stage 4 |
Annotations of Ll_transcript_95197
| Blastp | Transitional endoplasmic reticulum ATPase from Danio with 87.7% of identity |
|---|---|
| Blastx | Transitional endoplasmic reticulum ATPase from Danio with 87.7% of identity |
| Eggnog | Aaa atpase(COG0464) |
| Kegg | Link to kegg annotations (327197) |
| CantataDB | - |
| Mirbase | - |
| Ncbi protein | Link to NCBI protein (XP_003554388.1) |
| Pfam | Cell division protein 48 (CDC48), N-terminal domain (PF02359.17) |
| Rfam | - |
| GO | Links to GO: General; Genes and gene products; Annotations; Ontology; |