| Id Trinity | FTRINITY_DN4388_c0_g1_i1 |
|---|---|
| Name Transcript | Ll_transcript_183375 |
| Sequence | ATTTAATATATTGATTAATATCCGCCTCCTTCAAGTCACTTCAAGTCCTTTCACTGGACTTATATTTCTATTTGAAAGTGTGACCACACCCATCTAAAAT AGGCCTATCCGATACTGCAGTCATGGACATGATGATTTCCAATCTGCAACAGCAGCGGCAGATAACGGAACAGCTACGCAGAGAAGCAGCTGTGAAACGT ATACCCGTTTCACAAGCTATACAAGATATTATAAAATATATCAGGGAACGAGAAATGGAAGATTGTCTAATGGTTGGTTTTTCATCGCAGAAAGCTAATC CATTCAGAGAGAAAAGTAGTTGTGCA BLAST |
| Tissue | flowers |
| Gene name | LI_gene_11866; |
| Additional information | - |
| FPAB | abscising flower pedicels |
| FPNAB | non-abscising flower pedicels |
| LF1 | lower flowers stage 1 |
| LF2 | lower flowers stage 2 |
| LF3 | lower flowers stage 3 |
| LF4 | lower flowers stage 4 |
| UF1 | upper flowers stage 1 |
| UF2 | upper flowers stage 2 |
| UF3 | upper flowers stage 3 |
| UF4 | upper flowers stage 4 |
Annotations of Ll_transcript_183375
| Blastp | - |
|---|---|
| Blastx | Guanine nucleotide-binding protein subunit gamma-1 from Sophophora with 60.29% of identity |
| Eggnog | Guanine nucleotide-binding proteins (G proteins) are involved as a modulator or transducer in various transmembrane signaling systems. The beta and gamma chains are required for the GTPase activity, for replacement of GDP by GTP, and for G protein- effector interaction(ENOG41122JF) |
| Kegg | Link to kegg annotations (Dmel_CG8261) |
| CantataDB | - |
| Mirbase | - |
| Ncbi protein | Link to NCBI protein (XP_012568091.1) |
| Pfam | - |
| Rfam | - |
| GO | Links to GO: General; Genes and gene products; Annotations; Ontology; |