| Id Trinity | FTRINITY_DN44000_c0_g2_i1 |
|---|---|
| Name Transcript | Ll_transcript_250821 |
| Sequence | GTTTAGATTCCCCTGAGGATGCTGAGTTCATAGTGGCTAAAGCTATCCGTGACGGAGTTGTTGAAGCTACTCTGGACCCCGAAAAGGGTTATATGCGCAG CAAAGAAAGTGCTGACATCTATTGTACAAGGGAGCCTCAACTTGCATTCCACCAGAGAATTTCCTTCTGTCTGGATCTGCACAACCAGAGTGTTAAAGCA ATGCGGTACCCTCCCAAGTCTTATGGTAAAGAGCTAGAATCAGCTGAGGAGAGGCGTGAACGTGAACAGCAGGATCTTGAGCTTGCCAAGGAAATGGCAG AAGAAGATGAT BLAST |
| Tissue | flowers |
| Gene name | LI_gene_12002; |
| Additional information | details; |
| FPAB | abscising flower pedicels |
| FPNAB | non-abscising flower pedicels |
| LF1 | lower flowers stage 1 |
| LF2 | lower flowers stage 2 |
| LF3 | lower flowers stage 3 |
| LF4 | lower flowers stage 4 |
| UF1 | upper flowers stage 1 |
| UF2 | upper flowers stage 2 |
| UF3 | upper flowers stage 3 |
| UF4 | upper flowers stage 4 |
Annotations of Ll_transcript_250821
| Blastp | Probable 26S proteasome non-ATPase regulatory subunit 3 from Anopheles with 97.09% of identity |
|---|---|
| Blastx | Probable 26S proteasome non-ATPase regulatory subunit 3 from Anopheles with 97.09% of identity |
| Eggnog | 26S proteasome nonATPase regulatory subunit(ENOG410XS40) |
| Kegg | Link to kegg annotations (AgaP_AGAP009082) |
| CantataDB | - |
| Mirbase | - |
| Ncbi protein | Link to NCBI protein (XP_004500920.1) |
| Pfam | Proteasome regulatory subunit C-terminal (PF08375.10) |
| Rfam | - |
| GO | Links to GO: General; Genes and gene products; Annotations; Ontology; Links to GO: General; Genes and gene products; Annotations; Ontology; |