Id Trinity | FTRINITY_DN44000_c0_g2_i1 |
---|---|
Name Transcript | Ll_transcript_250821 |
Sequence | GTTTAGATTCCCCTGAGGATGCTGAGTTCATAGTGGCTAAAGCTATCCGTGACGGAGTTGTTGAAGCTACTCTGGACCCCGAAAAGGGTTATATGCGCAG CAAAGAAAGTGCTGACATCTATTGTACAAGGGAGCCTCAACTTGCATTCCACCAGAGAATTTCCTTCTGTCTGGATCTGCACAACCAGAGTGTTAAAGCA ATGCGGTACCCTCCCAAGTCTTATGGTAAAGAGCTAGAATCAGCTGAGGAGAGGCGTGAACGTGAACAGCAGGATCTTGAGCTTGCCAAGGAAATGGCAG AAGAAGATGAT BLAST |
Tissue | flowers |
Gene name | LI_gene_12002; |
Additional information | details; |
FPAB | abscising flower pedicels |
FPNAB | non-abscising flower pedicels |
LF1 | lower flowers stage 1 |
LF2 | lower flowers stage 2 |
LF3 | lower flowers stage 3 |
LF4 | lower flowers stage 4 |
UF1 | upper flowers stage 1 |
UF2 | upper flowers stage 2 |
UF3 | upper flowers stage 3 |
UF4 | upper flowers stage 4 |
Annotations of Ll_transcript_250821
Blastp | Probable 26S proteasome non-ATPase regulatory subunit 3 from Anopheles with 97.09% of identity |
---|---|
Blastx | Probable 26S proteasome non-ATPase regulatory subunit 3 from Anopheles with 97.09% of identity |
Eggnog | 26S proteasome nonATPase regulatory subunit(ENOG410XS40) |
Kegg | Link to kegg annotations (AgaP_AGAP009082) |
CantataDB | - |
Mirbase | - |
Ncbi protein | Link to NCBI protein (XP_004500920.1) |
Pfam | Proteasome regulatory subunit C-terminal (PF08375.10) |
Rfam | - |
GO | Links to GO: General; Genes and gene products; Annotations; Ontology; Links to GO: General; Genes and gene products; Annotations; Ontology; |