Id Trinity | FTRINITY_DN44080_c0_g2_i1 |
---|---|
Name Transcript | Ll_transcript_250814 |
Sequence | GTTGAATTGTTCATAATATTGTTAGTGTTTTACGAAGTTAAATATATTCAGATATATTTTCAAGCTTTTAATCATGTTCTTAACACGGTCAGAATACGAT AGAGGAGTAAACACATTCTCTCCAGAAGGCAGACTATTTCAGGTGGAATATGCTATTGAAGCAATTAAATTGGGTTCCACGGCCATTGGCATTTGTACAC CTGAAGGAGTAGTATTAGGTGTAGAAAAACGAATCACTTCACCGC BLAST |
Tissue | flowers |
Gene name | LI_gene_12089; |
Additional information | - |
FPAB | abscising flower pedicels |
FPNAB | non-abscising flower pedicels |
LF1 | lower flowers stage 1 |
LF2 | lower flowers stage 2 |
LF3 | lower flowers stage 3 |
LF4 | lower flowers stage 4 |
UF1 | upper flowers stage 1 |
UF2 | upper flowers stage 2 |
UF3 | upper flowers stage 3 |
UF4 | upper flowers stage 4 |
Annotations of Ll_transcript_250814
Blastp | - |
---|---|
Blastx | Proteasome subunit alpha type-5 from Sophophora with 98.25% of identity |
Eggnog | The proteasome is a multicatalytic proteinase complex which is characterized by its ability to cleave peptides with Arg, Phe, Tyr, Leu, and Glu adjacent to the leaving group at neutral or slightly basic pH. The proteasome has an ATP-dependent proteolytic activity (By similarity)(COG0638) |
Kegg | Link to kegg annotations (Dmel_CG10938) |
CantataDB | - |
Mirbase | - |
Ncbi protein | Link to NCBI protein (XP_020213057.1) |
Pfam | - |
Rfam | - |
GO | Links to GO: General; Genes and gene products; Annotations; Ontology; |