| Id Trinity | FTRINITY_DN44122_c0_g1_i2 |
|---|---|
| Name Transcript | Ll_transcript_77860 |
| Sequence | GGTCTGCCTCTCAAAGTGTCCATTTCTGTGCCGTAACCATGGTGGACAAGAAGGTTGCCAAGAAGGAGGGGGGCAAGGATGCCAGCAAGAATCCCATGAG GGAAACCCGCATCCGCAAATTATGCCTTAACATTTGTGTGGGAGAGTCTGGTGACAGACTTACACGAGCAGCCAAGGTGCTGGAACAGCTCACTGGACAA CAGCCCGTGTTCTCCAAGGCTAGGTACACTGTCCGTTCCTTCGGTATTAGGCGTAATGAGAAGATCGCTGTCCACTGCACCGTCCGTGGCGCCAAGGCCG AAGAAATCTTAGAAAGAGGACTTAAGGTTCGTGAATATGAATTGAGGAGAGAGAACTTTTCATGCACTGGAAACTTTGGTTTTGGTATCCAGGAACACAT TGATCTGGGTATCAAGTACGACCCTAGTATTGGTATCTATGGTCTCGATTTCTTCATCGTCCTTAG BLAST |
| Tissue | flowers |
| Gene name | LI_gene_12134; |
| Additional information | details; |
| FPAB | abscising flower pedicels |
| FPNAB | non-abscising flower pedicels |
| LF1 | lower flowers stage 1 |
| LF2 | lower flowers stage 2 |
| LF3 | lower flowers stage 3 |
| LF4 | lower flowers stage 4 |
| UF1 | upper flowers stage 1 |
| UF2 | upper flowers stage 2 |
| UF3 | upper flowers stage 3 |
| UF4 | upper flowers stage 4 |
Annotations of Ll_transcript_77860
| Blastp | 60S ribosomal protein L11 from Sophophora with 93.08% of identity |
|---|---|
| Blastx | 60S ribosomal protein L11 from Sophophora with 93.08% of identity |
| Eggnog | This is 1 of the proteins that binds and probably mediates the attachment of the 5S RNA into the large ribosomal subunit, where it forms part of the central protuberance. In the 70S ribosome it contacts protein S13 of the 30S subunit (bridge B1b), connecting the 2 subunits(COG0094) |
| Kegg | Link to kegg annotations (Dmel_CG7726) |
| CantataDB | - |
| Mirbase | - |
| Ncbi protein | Link to NCBI protein (XP_006578416.1) |
| Pfam | Ribosomal protein L5 (PF00281.18) |
| Rfam | - |
| GO | Links to GO: General; Genes and gene products; Annotations; Ontology; |