| Id Trinity | FTRINITY_DN44166_c0_g2_i1 |
|---|---|
| Name Transcript | Ll_transcript_77833 |
| Sequence | CGACGAAGTTGTTGAGGCTCTGAGGAGGCTTCCAGAAGAGACTCTTCTTCAAAGGATTTACCGTCACAACCGTGCTGCTAACCTGTCTATGACTCACTCT ATCCTTCCAGAAGACCAGTGGACAAAGATTGAGGAGGATGTCCCATACCTCTCTCCACTTGTAGAAGAAGTTGAGGCTGAAATTGCCGAGAAGAAGAATT GGGAGGAGAACAATCCCCTGTAGAGAGCTAAACTCAATGTAATCTTAGAATGTTTTATTTTACCGGGCACTGTTATTGGCACGGCCGGAATGAATGTATG TAAATAATTCTGTACATG BLAST |
| Tissue | flowers |
| Gene name | LI_gene_12182; |
| Additional information | - |
| FPAB | abscising flower pedicels |
| FPNAB | non-abscising flower pedicels |
| LF1 | lower flowers stage 1 |
| LF2 | lower flowers stage 2 |
| LF3 | lower flowers stage 3 |
| LF4 | lower flowers stage 4 |
| UF1 | upper flowers stage 1 |
| UF2 | upper flowers stage 2 |
| UF3 | upper flowers stage 3 |
| UF4 | upper flowers stage 4 |
Annotations of Ll_transcript_77833
| Blastp | - |
|---|---|
| Blastx | Cytochrome b-c1 complex subunit 7 from Bos with 55.77% of identity |
| Eggnog | component of the ubiquinol-cytochrome c reductase complex (complex III or cytochrome b-c1 complex), which is part of the mitochondrial respiratory chain (By similarity)(ENOG4111V1G) |
| Kegg | Link to kegg annotations (616871) |
| CantataDB | - |
| Mirbase | - |
| Ncbi protein | Link to NCBI protein (XP_020981022.1) |
| Pfam | - |
| Rfam | - |
| GO | Links to GO: General; Genes and gene products; Annotations; Ontology; |