| Id Trinity | FTRINITY_DN44381_c0_g2_i1 |
|---|---|
| Name Transcript | Ll_transcript_96829 |
| Sequence | CGAGGAGCGTGAACATGCCATCAAGCTTATTGAGTACCTTCTGATGCGTGGTCAGCTAACTAAGGATGTTGGTGATCTCATCAAGGACCCTCGCCCCAAG GATGATGTCACTGCCTGGGTTGATGGTGTCAGTGCCCTCAAGGATGCCCTCAAGCTGGAGGCCAGCGTTACCAACAACATCCGTGACATTATTGCTGTCT GCGAGGACCCTGGCGAATCCAAGTTCAATGACTACCATCTGGTTGATTATTTGACTGGAGATTTCTTGGACGAGCAGTACAAGGGACAGCGTGAGCTCGC GGGCATGATTTCTACCCTTGACAAGATGATGCATTCCCATGGTG BLAST |
| Tissue | flowers |
| Gene name | LI_gene_12405; |
| Additional information | details; |
| FPAB | abscising flower pedicels |
| FPNAB | non-abscising flower pedicels |
| LF1 | lower flowers stage 1 |
| LF2 | lower flowers stage 2 |
| LF3 | lower flowers stage 3 |
| LF4 | lower flowers stage 4 |
| UF1 | upper flowers stage 1 |
| UF2 | upper flowers stage 2 |
| UF3 | upper flowers stage 3 |
| UF4 | upper flowers stage 4 |
Annotations of Ll_transcript_96829
| Blastp | Ferritin subunit from Stegomyia with 52.68% of identity |
|---|---|
| Blastx | Ferritin subunit from Stegomyia with 52.68% of identity |
| Eggnog | Stores iron in a soluble, non-toxic, readily available form. Important for iron homeostasis (By similarity)(COG1528) |
| Kegg | Link to kegg annotations (AaeL_AAEL007385) |
| CantataDB | - |
| Mirbase | - |
| Ncbi protein | Link to NCBI protein (XP_017418689.1) |
| Pfam | Ferritin-like domain (PF00210.23) |
| Rfam | - |
| GO | Links to GO: General; Genes and gene products; Annotations; Ontology; Links to GO: General; Genes and gene products; Annotations; Ontology; |