| Id Trinity | FTRINITY_DN44608_c0_g1_i1 |
|---|---|
| Name Transcript | Ll_transcript_4389 |
| Sequence | TTGCGGCGACCAACAGGGTTGATATTTTGGATAAGGCCTTGTTGAGGCCTGGTCGTTTCGATCGTCAGATTTTCGTACCCGCTCCCGATATTAAAGGAAG AGCCAGTATATTCAAGGTTCACTTGGGACCATTAAAAACCAACTTGGATAAGATTGATCTTTCCAGAAAAATGGCAGCGCATACCCCAGGATTTACCGGA GCCGACATCGCAAATGTCTGCAATGAAGCTGCGCTGATTGCAGCAAGAGATTTAAACGACTCAATTAATATGAAACATTTTGAACAGGCTATAGAACGTG TTGTCGCAGGCATGGAAAAAAAAACCAACGTACTTTCGCCTGAAGAAAAACGAAC BLAST |
| Tissue | flowers |
| Gene name | LI_gene_12668; |
| Additional information | details; |
| FPAB | abscising flower pedicels |
| FPNAB | non-abscising flower pedicels |
| LF1 | lower flowers stage 1 |
| LF2 | lower flowers stage 2 |
| LF3 | lower flowers stage 3 |
| LF4 | lower flowers stage 4 |
| UF1 | upper flowers stage 1 |
| UF2 | upper flowers stage 2 |
| UF3 | upper flowers stage 3 |
| UF4 | upper flowers stage 4 |
Annotations of Ll_transcript_4389
| Blastp | AFG3-like protein 2 from Homo with 75.63% of identity |
|---|---|
| Blastx | AFG3-like protein 2 from Homo with 75.63% of identity |
| Eggnog | Acts as a processive, ATP-dependent zinc metallopeptidase for both cytoplasmic and membrane proteins. Plays a role in the quality control of integral membrane proteins (By similarity)(COG0465) |
| Kegg | Link to kegg annotations (10939) |
| CantataDB | - |
| Mirbase | - |
| Ncbi protein | Link to NCBI protein (XP_020984789.1) |
| Pfam | Peptidase family M41 (PF01434.17) |
| Rfam | - |
| GO | Links to GO: General; Genes and gene products; Annotations; Ontology; Links to GO: General; Genes and gene products; Annotations; Ontology; |