Ll_transcript_153281

Id Trinity	FTRINITY_DN44922_c0_g2_i1
Name Transcript	Ll_transcript_153281
Sequence	CCCCTTGTGAAGCTGAAGCTCAGTGTGCTGCCATGGTGAAAGCAGGCAAAGTATATGCTACTGCGACAGAGGATATGGACGCTCTCACATTTGGATCCAC TGTCTTGCTGAGACATATGACTTTCAGTGAAGCAAGAAAAATGCCAATTCAAGAATTTCACTTCAATAAAGTTTTGGAAGATCTGGAGCTAAATCGAGAT GAATTCATTGATTTGTGCATTTTATTGGGCTGTGATTACTGTGACAGTATTCGTGGTATTGGTCCTAAACGAG BLAST
Tissue	flowers
Gene name	LI_gene_13007;
Additional information	-

FPAB	abscising flower pedicels
FPNAB	non-abscising flower pedicels
LF1	lower flowers stage 1
LF2	lower flowers stage 2
LF3	lower flowers stage 3
LF4	lower flowers stage 4
UF1	upper flowers stage 1
UF2	upper flowers stage 2
UF3	upper flowers stage 3
UF4	upper flowers stage 4

Blastp	-
Blastx	Flap endonuclease 1 from Stegomyia with 84.44% of identity
Eggnog	Structure-specific nuclease with 5'-flap endonuclease and 5'-3' exonuclease activities involved in DNA replication and repair. During DNA replication, cleaves the 5'-overhanging flap structure that is generated by displacement synthesis when DNA polymerase encounters the 5'-end of a downstream Okazaki fragment. It enters the flap from the 5'-end and then tracks to cleave the flap base, leaving a nick for ligation. Also involved in the long patch base excision repair (LP-BER) pathway, by cleaving within the apurinic apyrimidinic (AP) site-terminated flap. Acts as a genome stabilization factor that prevents flaps from equilibrating into structurs that lead to duplications and deletions. Also possesses 5'-3' exonuclease activity on nicked or gapped double- stranded DNA, and exhibits RNase H activity. Also involved in replication and repair of rDNA and in repairing mitochondrial DNA (By similarity)(COG0258)
Kegg	Link to kegg annotations (AaeL_AAEL005870)
CantataDB	-
Mirbase	-
Ncbi protein	Link to NCBI protein (XP_006605770.1)
Pfam	-
Rfam	-
GO	Links to GO: General; Genes and gene products; Annotations; Ontology;